Incidental Mutation 'R9117:Mrps9'
ID 692578
Institutional Source Beutler Lab
Gene Symbol Mrps9
Ensembl Gene ENSMUSG00000060679
Gene Name mitochondrial ribosomal protein S9
Synonyms
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.930) question?
Stock # R9117 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 42851233-42905683 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to G at 42903377 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Alanine at position 332 (S332A)
Ref Sequence ENSEMBL: ENSMUSP00000056855 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057208]
AlphaFold Q9D7N3
Predicted Effect probably benign
Transcript: ENSMUST00000057208
AA Change: S332A

PolyPhen 2 Score 0.216 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000056855
Gene: ENSMUSG00000060679
AA Change: S332A

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 194 207 N/A INTRINSIC
Pfam:Ribosomal_S9 268 390 7.3e-39 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000201108
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 28S subunit protein. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310061I04Rik C G 17: 35,893,071 S185T probably benign Het
Agfg1 T G 1: 82,894,495 F516L possibly damaging Het
Akap5 T A 12: 76,327,818 M8K possibly damaging Het
Aldh1l2 C T 10: 83,506,681 V535I probably benign Het
Atg3 T C 16: 45,186,201 V277A probably damaging Het
Bloc1s6 C T 2: 122,746,614 P168L probably damaging Het
Ccdc173 G T 2: 69,781,759 S175* probably null Het
Ccr7 A G 11: 99,145,260 Y279H probably damaging Het
Clint1 A G 11: 45,890,735 T211A probably damaging Het
Dchs2 T G 3: 83,269,355 D873E probably benign Het
Dhx30 A G 9: 110,097,096 L149P probably damaging Het
Dtx1 A G 5: 120,710,291 V8A probably benign Het
Enpp3 T A 10: 24,826,180 K91N possibly damaging Het
Fcho1 C T 8: 71,712,068 G523E possibly damaging Het
Ffar2 T C 7: 30,819,191 E308G probably damaging Het
Foxb2 T C 19: 16,873,394 K83E unknown Het
Git2 A G 5: 114,749,560 probably null Het
Gm10024 T C 10: 77,711,505 S17P unknown Het
Greb1l A T 18: 10,542,422 Y1339F probably benign Het
Grhl2 T A 15: 37,270,668 D33E probably damaging Het
Herc4 C A 10: 63,290,521 L551I probably benign Het
Igfn1 T A 1: 135,974,790 T390S probably benign Het
Ighv3-1 T A 12: 113,964,469 H90L probably benign Het
Jag2 G T 12: 112,913,659 Y697* probably null Het
Kif1c T C 11: 70,704,972 V168A probably damaging Het
Lipn T C 19: 34,068,641 W5R probably damaging Het
Mavs G A 2: 131,245,325 A248T probably benign Het
Megf10 G A 18: 57,259,701 G390D probably damaging Het
Mib1 A G 18: 10,793,023 H653R probably benign Het
Muc5b T C 7: 141,869,333 C4498R possibly damaging Het
Myo15b T A 11: 115,887,917 I1157N possibly damaging Het
Myo9b C T 8: 71,347,807 T1002M probably benign Het
Nav3 T A 10: 109,684,239 M2328L probably benign Het
Olfr186 T C 16: 59,027,290 I206V probably benign Het
Olfr917 T A 9: 38,665,810 E11D probably benign Het
Pawr T C 10: 108,333,279 S155P probably damaging Het
Pcdhb15 G T 18: 37,475,037 V441F probably damaging Het
Plekhg3 A G 12: 76,578,131 D1250G probably benign Het
Ptprs T A 17: 56,435,853 M430L possibly damaging Het
Raly T A 2: 154,861,865 S119T probably damaging Het
Serpinb6a A T 13: 33,925,429 S128T probably benign Het
Slc22a7 A G 17: 46,437,103 F210L probably damaging Het
Speg G T 1: 75,387,800 S275I probably damaging Het
Stk32c C T 7: 139,188,225 D47N unknown Het
Stra6 T G 9: 58,152,539 S594R probably benign Het
Sun2 T C 15: 79,730,316 H295R probably benign Het
Syne1 T C 10: 5,103,667 Q7470R probably damaging Het
Syt14 A T 1: 192,983,818 H259Q unknown Het
Trim50 A G 5: 135,353,683 S130G possibly damaging Het
Tyw1 G A 5: 130,269,224 R202Q probably damaging Het
Wdr18 T C 10: 79,965,320 V189A probably benign Het
Zfat C A 15: 68,187,069 A206S probably damaging Het
Other mutations in Mrps9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00897:Mrps9 APN 1 42905459 missense probably damaging 1.00
IGL01134:Mrps9 APN 1 42903397 missense probably damaging 0.97
IGL01557:Mrps9 APN 1 42851350 missense probably benign
IGL02541:Mrps9 APN 1 42862654 splice site probably null
PIT4402001:Mrps9 UTSW 1 42896098 missense probably benign 0.10
R0598:Mrps9 UTSW 1 42905417 missense probably damaging 1.00
R1718:Mrps9 UTSW 1 42903399 missense probably damaging 1.00
R4195:Mrps9 UTSW 1 42901094 intron probably benign
R4196:Mrps9 UTSW 1 42901094 intron probably benign
R4695:Mrps9 UTSW 1 42862515 missense possibly damaging 0.59
R4840:Mrps9 UTSW 1 42898415 intron probably benign
R5033:Mrps9 UTSW 1 42895331 splice site probably null
R5489:Mrps9 UTSW 1 42898433 splice site probably benign
R5876:Mrps9 UTSW 1 42895378 missense probably damaging 0.99
R6891:Mrps9 UTSW 1 42905413 missense probably damaging 1.00
R7015:Mrps9 UTSW 1 42898546 missense probably benign 0.04
R7940:Mrps9 UTSW 1 42862648 missense probably damaging 0.98
R8679:Mrps9 UTSW 1 42879755 missense probably damaging 0.99
Z1177:Mrps9 UTSW 1 42899458 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- CAGGAGGAGCCATGTTTCTG -3'
(R):5'- TTCTGCAGAATGGAGGGATG -3'

Sequencing Primer
(F):5'- AGCCATGTTTCTGTGATTGGTGTAAC -3'
(R):5'- TCCTGAGAGCCACACCAGTG -3'
Posted On 2021-12-30