Incidental Mutation 'R9117:Dtx1'
ID 692589
Institutional Source Beutler Lab
Gene Symbol Dtx1
Ensembl Gene ENSMUSG00000029603
Gene Name deltex 1, E3 ubiquitin ligase
Synonyms Fxit1
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9117 (G1)
Quality Score 184.009
Status Validated
Chromosome 5
Chromosomal Location 120680202-120711927 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 120710291 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 8 (V8A)
Ref Sequence ENSEMBL: ENSMUSP00000031607 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031607]
AlphaFold Q61010
Predicted Effect probably benign
Transcript: ENSMUST00000031607
AA Change: V8A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000031607
Gene: ENSMUSG00000029603
AA Change: V8A

DomainStartEndE-ValueType
WWE 23 102 1.29e-38 SMART
WWE 104 179 3.88e-33 SMART
low complexity region 226 251 N/A INTRINSIC
low complexity region 258 290 N/A INTRINSIC
low complexity region 367 384 N/A INTRINSIC
low complexity region 387 397 N/A INTRINSIC
RING 418 478 5.82e-6 SMART
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 98% (56/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Studies in Drosophila have identified this gene as encoding a positive regulator of the Notch-signaling pathway. The human gene encodes a protein of unknown function; however, it may play a role in basic helix-loop-helix transcription factor activity. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice are viable and fertile with normal B and T cell devlepment and function and no gross abnormalities in any of the major organs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310061I04Rik C G 17: 35,893,071 S185T probably benign Het
Agfg1 T G 1: 82,894,495 F516L possibly damaging Het
Akap5 T A 12: 76,327,818 M8K possibly damaging Het
Aldh1l2 C T 10: 83,506,681 V535I probably benign Het
Atg3 T C 16: 45,186,201 V277A probably damaging Het
Bloc1s6 C T 2: 122,746,614 P168L probably damaging Het
Ccdc173 G T 2: 69,781,759 S175* probably null Het
Ccr7 A G 11: 99,145,260 Y279H probably damaging Het
Clint1 A G 11: 45,890,735 T211A probably damaging Het
Dchs2 T G 3: 83,269,355 D873E probably benign Het
Dhx30 A G 9: 110,097,096 L149P probably damaging Het
Dnah1 T C 14: 31,311,624 probably benign Het
Enpp3 T A 10: 24,826,180 K91N possibly damaging Het
Fcho1 C T 8: 71,712,068 G523E possibly damaging Het
Ffar2 T C 7: 30,819,191 E308G probably damaging Het
Foxb2 T C 19: 16,873,394 K83E unknown Het
Git2 A G 5: 114,749,560 probably null Het
Gm10024 T C 10: 77,711,505 S17P unknown Het
Greb1l A T 18: 10,542,422 Y1339F probably benign Het
Grhl2 T A 15: 37,270,668 D33E probably damaging Het
Herc4 C A 10: 63,290,521 L551I probably benign Het
Igfn1 T A 1: 135,974,790 T390S probably benign Het
Ighv3-1 T A 12: 113,964,469 H90L probably benign Het
Jag2 G T 12: 112,913,659 Y697* probably null Het
Kif1c T C 11: 70,704,972 V168A probably damaging Het
Lipn T C 19: 34,068,641 W5R probably damaging Het
Mavs G A 2: 131,245,325 A248T probably benign Het
Megf10 G A 18: 57,259,701 G390D probably damaging Het
Mib1 A G 18: 10,793,023 H653R probably benign Het
Mrps9 T G 1: 42,903,377 S332A probably benign Het
Muc5b T C 7: 141,869,333 C4498R possibly damaging Het
Myo15b T A 11: 115,887,917 I1157N possibly damaging Het
Myo9b C T 8: 71,347,807 T1002M probably benign Het
Nav3 T A 10: 109,684,239 M2328L probably benign Het
Olfr186 T C 16: 59,027,290 I206V probably benign Het
Olfr917 T A 9: 38,665,810 E11D probably benign Het
Pawr T C 10: 108,333,279 S155P probably damaging Het
Pcdhb15 G T 18: 37,475,037 V441F probably damaging Het
Plekhg3 A G 12: 76,578,131 D1250G probably benign Het
Ptprs T A 17: 56,435,853 M430L possibly damaging Het
Raly T A 2: 154,861,865 S119T probably damaging Het
Serpinb6a A T 13: 33,925,429 S128T probably benign Het
Sirt3 C T 7: 140,869,449 probably benign Het
Slc22a7 A G 17: 46,437,103 F210L probably damaging Het
Speg G T 1: 75,387,800 S275I probably damaging Het
Stk32c C T 7: 139,188,225 D47N unknown Het
Stra6 T G 9: 58,152,539 S594R probably benign Het
Sun2 T C 15: 79,730,316 H295R probably benign Het
Syne1 T C 10: 5,103,667 Q7470R probably damaging Het
Syt14 A T 1: 192,983,818 H259Q unknown Het
Toporsl A T 4: 52,609,943 probably benign Het
Trim50 A G 5: 135,353,683 S130G possibly damaging Het
Tyw1 G A 5: 130,269,224 R202Q probably damaging Het
Wdr18 T C 10: 79,965,320 V189A probably benign Het
Zfat C A 15: 68,187,069 A206S probably damaging Het
Other mutations in Dtx1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02733:Dtx1 APN 5 120681435 missense probably damaging 1.00
IGL03104:Dtx1 APN 5 120694965 missense possibly damaging 0.77
IGL03139:Dtx1 APN 5 120694890 missense probably damaging 0.96
R0094:Dtx1 UTSW 5 120682624 missense probably damaging 1.00
R0173:Dtx1 UTSW 5 120682753 unclassified probably benign
R0268:Dtx1 UTSW 5 120681291 missense probably damaging 1.00
R0375:Dtx1 UTSW 5 120681399 missense probably damaging 1.00
R0452:Dtx1 UTSW 5 120694992 missense possibly damaging 0.94
R1109:Dtx1 UTSW 5 120710419 start gained probably benign
R1456:Dtx1 UTSW 5 120710504 utr 5 prime probably benign
R1541:Dtx1 UTSW 5 120710346 start gained probably benign
R1554:Dtx1 UTSW 5 120683321 missense probably damaging 1.00
R2042:Dtx1 UTSW 5 120694476 missense probably benign 0.24
R2568:Dtx1 UTSW 5 120710184 missense possibly damaging 0.84
R3946:Dtx1 UTSW 5 120681286 missense possibly damaging 0.53
R4697:Dtx1 UTSW 5 120694408 critical splice donor site probably null
R6150:Dtx1 UTSW 5 120681363 missense probably damaging 1.00
R6564:Dtx1 UTSW 5 120695017 missense probably benign 0.13
R6980:Dtx1 UTSW 5 120681357 missense probably damaging 1.00
R7000:Dtx1 UTSW 5 120695083 missense probably damaging 0.98
R7399:Dtx1 UTSW 5 120682393 missense possibly damaging 0.60
Z1176:Dtx1 UTSW 5 120683295 missense probably benign
Z1177:Dtx1 UTSW 5 120681351 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTAGGTCGATGATGTAGGGCAC -3'
(R):5'- TAGGACAGACATTGCCTACCG -3'

Sequencing Primer
(F):5'- ACCAGCTGGGCGTCCAC -3'
(R):5'- CCTAACCCAGGCCTCTAGG -3'
Posted On 2021-12-30