Mutagenetix > Incidental Mutation

Incidental Mutation 'R9117:Tyw1'

692590

Institutional Source

Beutler Lab

Gene Symbol

Tyw1

Ensembl Gene

ENSMUSG00000056310

Gene Name

tRNA-yW synthesizing protein 1 homolog (S. cerevisiae)

Synonyms

Rsafd1

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R9117 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

130255619-130341563 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 130269224 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Glutamine at position 202 (R202Q)

Ref Sequence

ENSEMBL: ENSMUSP00000037173 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000040213] [ENSMUST00000044204] [ENSMUST00000100662] [ENSMUST00000147619]

AlphaFold

Q8BJM7

Predicted Effect

probably damaging
Transcript: ENSMUST00000040213
AA Change: R202Q

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000037173
Gene: ENSMUSG00000056310
AA Change: R202Q

Domain	Start	End	E-Value	Type
transmembrane domain	20	39	N/A	INTRINSIC
Pfam:Flavodoxin_1	73	224	1.6e-27	PFAM
low complexity region	276	288	N/A	INTRINSIC
Pfam:Radical_SAM	399	581	1.1e-29	PFAM
Pfam:Wyosine_form	583	646	3.6e-29	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000044204
AA Change: R202Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000047318
Gene: ENSMUSG00000056310
AA Change: R202Q

Domain	Start	End	E-Value	Type
transmembrane domain	20	39	N/A	INTRINSIC
Pfam:Flavodoxin_1	73	224	1.5e-27	PFAM
low complexity region	276	288	N/A	INTRINSIC
transmembrane domain	375	397	N/A	INTRINSIC
transmembrane domain	423	445	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000100662
AA Change: R202Q

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000098226
Gene: ENSMUSG00000056310
AA Change: R202Q

Domain	Start	End	E-Value	Type
transmembrane domain	20	39	N/A	INTRINSIC
Pfam:Flavodoxin_1	73	224	4.9e-28	PFAM
low complexity region	276	288	N/A	INTRINSIC
low complexity region	319	332	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000147619
AA Change: R179Q

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000123693
Gene: ENSMUSG00000056310
AA Change: R179Q

Domain	Start	End	E-Value	Type
Pfam:Flavodoxin_1	50	201	4.3e-28	PFAM

Meta Mutation Damage Score

0.3244

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

98% (56/57)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Wybutosine (yW) is a hypermodified guanosine found in phenylalanine tRNA adjacent to the anticodon that stabilizes codon-anticodon interactions in the ribosome. In yeast, the homolog of this gene is essential for the synthesis of wybutosine. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310061I04Rik	C	G	17: 35,893,071	S185T	probably benign	Het
Agfg1	T	G	1: 82,894,495	F516L	possibly damaging	Het
Akap5	T	A	12: 76,327,818	M8K	possibly damaging	Het
Aldh1l2	C	T	10: 83,506,681	V535I	probably benign	Het
Atg3	T	C	16: 45,186,201	V277A	probably damaging	Het
Bloc1s6	C	T	2: 122,746,614	P168L	probably damaging	Het
Ccdc173	G	T	2: 69,781,759	S175*	probably null	Het
Ccr7	A	G	11: 99,145,260	Y279H	probably damaging	Het
Clint1	A	G	11: 45,890,735	T211A	probably damaging	Het
Dchs2	T	G	3: 83,269,355	D873E	probably benign	Het
Dhx30	A	G	9: 110,097,096	L149P	probably damaging	Het
Dnah1	T	C	14: 31,311,624		probably benign	Het
Dtx1	A	G	5: 120,710,291	V8A	probably benign	Het
Enpp3	T	A	10: 24,826,180	K91N	possibly damaging	Het
Fcho1	C	T	8: 71,712,068	G523E	possibly damaging	Het
Ffar2	T	C	7: 30,819,191	E308G	probably damaging	Het
Foxb2	T	C	19: 16,873,394	K83E	unknown	Het
Git2	A	G	5: 114,749,560		probably null	Het
Gm10024	T	C	10: 77,711,505	S17P	unknown	Het
Greb1l	A	T	18: 10,542,422	Y1339F	probably benign	Het
Grhl2	T	A	15: 37,270,668	D33E	probably damaging	Het
Herc4	C	A	10: 63,290,521	L551I	probably benign	Het
Igfn1	T	A	1: 135,974,790	T390S	probably benign	Het
Ighv3-1	T	A	12: 113,964,469	H90L	probably benign	Het
Jag2	G	T	12: 112,913,659	Y697*	probably null	Het
Kif1c	T	C	11: 70,704,972	V168A	probably damaging	Het
Lipn	T	C	19: 34,068,641	W5R	probably damaging	Het
Mavs	G	A	2: 131,245,325	A248T	probably benign	Het
Megf10	G	A	18: 57,259,701	G390D	probably damaging	Het
Mib1	A	G	18: 10,793,023	H653R	probably benign	Het
Mrps9	T	G	1: 42,903,377	S332A	probably benign	Het
Muc5b	T	C	7: 141,869,333	C4498R	possibly damaging	Het
Myo15b	T	A	11: 115,887,917	I1157N	possibly damaging	Het
Myo9b	C	T	8: 71,347,807	T1002M	probably benign	Het
Nav3	T	A	10: 109,684,239	M2328L	probably benign	Het
Olfr186	T	C	16: 59,027,290	I206V	probably benign	Het
Olfr917	T	A	9: 38,665,810	E11D	probably benign	Het
Pawr	T	C	10: 108,333,279	S155P	probably damaging	Het
Pcdhb15	G	T	18: 37,475,037	V441F	probably damaging	Het
Plekhg3	A	G	12: 76,578,131	D1250G	probably benign	Het
Ptprs	T	A	17: 56,435,853	M430L	possibly damaging	Het
Raly	T	A	2: 154,861,865	S119T	probably damaging	Het
Serpinb6a	A	T	13: 33,925,429	S128T	probably benign	Het
Sirt3	C	T	7: 140,869,449		probably benign	Het
Slc22a7	A	G	17: 46,437,103	F210L	probably damaging	Het
Speg	G	T	1: 75,387,800	S275I	probably damaging	Het
Stk32c	C	T	7: 139,188,225	D47N	unknown	Het
Stra6	T	G	9: 58,152,539	S594R	probably benign	Het
Sun2	T	C	15: 79,730,316	H295R	probably benign	Het
Syne1	T	C	10: 5,103,667	Q7470R	probably damaging	Het
Syt14	A	T	1: 192,983,818	H259Q	unknown	Het
Toporsl	A	T	4: 52,609,943		probably benign	Het
Trim50	A	G	5: 135,353,683	S130G	possibly damaging	Het
Wdr18	T	C	10: 79,965,320	V189A	probably benign	Het
Zfat	C	A	15: 68,187,069	A206S	probably damaging	Het

Other mutations in Tyw1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02329:Tyw1	APN	5	130267080	missense	probably benign	0.20
IGL02873:Tyw1	APN	5	130335330	missense	probably benign	0.00
IGL02879:Tyw1	APN	5	130296771	missense	probably damaging	1.00
IGL03080:Tyw1	APN	5	130267055	missense	probably damaging	1.00
IGL03291:Tyw1	APN	5	130299993	missense	probably damaging	1.00
IGL03297:Tyw1	APN	5	130340734	missense	probably damaging	1.00
remnant	UTSW	5	130262921	missense	probably damaging	0.99
schimmel	UTSW	5	130269224	missense	probably damaging	1.00
tyrone	UTSW	5	130296679	nonsense	probably null
yang	UTSW	5	130259035	missense	probably damaging	0.98
R1420:Tyw1	UTSW	5	130274745	critical splice donor site	probably null
R1650:Tyw1	UTSW	5	130288911	missense	possibly damaging	0.91
R1674:Tyw1	UTSW	5	130269328	missense	probably benign	0.01
R1789:Tyw1	UTSW	5	130258993	missense	probably damaging	0.99
R1996:Tyw1	UTSW	5	130262811	splice site	probably benign
R2421:Tyw1	UTSW	5	130269260	missense	probably damaging	1.00
R3913:Tyw1	UTSW	5	130259035	missense	probably damaging	0.98
R4412:Tyw1	UTSW	5	130335232	splice site	probably null
R4835:Tyw1	UTSW	5	130277058	missense	probably benign
R5058:Tyw1	UTSW	5	130277086	missense	probably benign	0.03
R5190:Tyw1	UTSW	5	130267915	nonsense	probably null
R5398:Tyw1	UTSW	5	130277157	intron	probably benign
R5459:Tyw1	UTSW	5	130274706	missense	probably damaging	1.00
R5597:Tyw1	UTSW	5	130274657	missense	probably benign	0.00
R5704:Tyw1	UTSW	5	130282022	nonsense	probably null
R5825:Tyw1	UTSW	5	130268088	missense	probably damaging	0.99
R5887:Tyw1	UTSW	5	130325699	missense	probably damaging	1.00
R6072:Tyw1	UTSW	5	130267911	missense	possibly damaging	0.92
R6349:Tyw1	UTSW	5	130277031	missense	possibly damaging	0.82
R6366:Tyw1	UTSW	5	130281951	unclassified	probably benign
R7012:Tyw1	UTSW	5	130277730	splice site	probably null
R7259:Tyw1	UTSW	5	130267872	splice site	probably null
R7328:Tyw1	UTSW	5	130262844	missense	probably benign	0.08
R7555:Tyw1	UTSW	5	130274706	missense	probably damaging	1.00
R8006:Tyw1	UTSW	5	130268072	missense	possibly damaging	0.87
R8171:Tyw1	UTSW	5	130300014	missense	probably benign	0.19
R8196:Tyw1	UTSW	5	130300021	missense	probably damaging	1.00
R8714:Tyw1	UTSW	5	130269224	missense	probably damaging	1.00
R8715:Tyw1	UTSW	5	130269224	missense	probably damaging	1.00
R8716:Tyw1	UTSW	5	130269224	missense	probably damaging	1.00
R8970:Tyw1	UTSW	5	130269224	missense	probably damaging	1.00
R8992:Tyw1	UTSW	5	130269224	missense	probably damaging	1.00
R9119:Tyw1	UTSW	5	130269224	missense	probably damaging	1.00
R9120:Tyw1	UTSW	5	130269224	missense	probably damaging	1.00
R9172:Tyw1	UTSW	5	130296679	nonsense	probably null
R9204:Tyw1	UTSW	5	130269224	missense	probably damaging	1.00
R9205:Tyw1	UTSW	5	130269224	missense	probably damaging	1.00
R9207:Tyw1	UTSW	5	130269224	missense	probably damaging	1.00
R9325:Tyw1	UTSW	5	130262921	missense	probably damaging	0.99
R9364:Tyw1	UTSW	5	130269224	missense	probably damaging	1.00
R9368:Tyw1	UTSW	5	130269224	missense	probably damaging	1.00
R9369:Tyw1	UTSW	5	130269224	missense	probably damaging	1.00
R9470:Tyw1	UTSW	5	130269224	missense	probably damaging	1.00
R9471:Tyw1	UTSW	5	130269224	missense	probably damaging	1.00
R9566:Tyw1	UTSW	5	130269224	missense	probably damaging	1.00
R9567:Tyw1	UTSW	5	130269224	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AATCCCTGGGTTTCTGCAGTG -3'
(R):5'- ATCCCCAGGATGCAATTCG -3'

Sequencing Primer
(F):5'- CTGGAAGCCTGCTTTAGAGGAC -3'
(R):5'- CAGGATGCAATTCGCCTTG -3'

Posted On

2021-12-30