Incidental Mutation 'R9117:Ffar2'
ID 692592
Institutional Source Beutler Lab
Gene Symbol Ffar2
Ensembl Gene ENSMUSG00000051314
Gene Name free fatty acid receptor 2
Synonyms Gpr43
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9117 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 30818348-30823775 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 30819191 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 308 (E308G)
Ref Sequence ENSEMBL: ENSMUSP00000052600 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053156] [ENSMUST00000163504] [ENSMUST00000168528] [ENSMUST00000186059] [ENSMUST00000186339] [ENSMUST00000186534]
AlphaFold Q8VCK6
Predicted Effect probably damaging
Transcript: ENSMUST00000053156
AA Change: E308G

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000052600
Gene: ENSMUSG00000051314
AA Change: E308G

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srv 10 284 3.1e-8 PFAM
Pfam:7tm_1 24 273 1.7e-37 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000163504
AA Change: E308G

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000127758
Gene: ENSMUSG00000051314
AA Change: E308G

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srv 10 284 3.2e-8 PFAM
Pfam:7tm_1 24 277 1.2e-28 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000129398
Gene: ENSMUSG00000051314
AA Change: E308G

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srv 10 284 3.1e-8 PFAM
Pfam:7tm_1 24 273 1.7e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000186059
SMART Domains Protein: ENSMUSP00000140484
Gene: ENSMUSG00000051314

DomainStartEndE-ValueType
Pfam:7tm_1 24 133 1.4e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000186339
SMART Domains Protein: ENSMUSP00000140493
Gene: ENSMUSG00000051314

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srv 8 175 1.9e-4 PFAM
Pfam:7tm_1 24 179 1.4e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000186534
SMART Domains Protein: ENSMUSP00000140215
Gene: ENSMUSG00000051314

DomainStartEndE-ValueType
Pfam:7tm_1 24 142 1.5e-22 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the GP40 family of G protein-coupled receptors that are clustered together on chromosome 19. The encoded protein is a receptor for short chain free fatty acids and may be involved in the inflammatory response and in regulating lipid plasma levels. [provided by RefSeq, Apr 2009]
PHENOTYPE: Mice homozygous for a null allele show altered granulocyte and neutrophil physiology and increased inflammation in models of induced colitis, arthritis and asthma, whereas homozygotes for a different null allele show reduced neutrophil recruitment and decreased susceptibility to induced colitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310061I04Rik C G 17: 35,893,071 S185T probably benign Het
Agfg1 T G 1: 82,894,495 F516L possibly damaging Het
Akap5 T A 12: 76,327,818 M8K possibly damaging Het
Aldh1l2 C T 10: 83,506,681 V535I probably benign Het
Atg3 T C 16: 45,186,201 V277A probably damaging Het
Bloc1s6 C T 2: 122,746,614 P168L probably damaging Het
Ccdc173 G T 2: 69,781,759 S175* probably null Het
Ccr7 A G 11: 99,145,260 Y279H probably damaging Het
Clint1 A G 11: 45,890,735 T211A probably damaging Het
Dchs2 T G 3: 83,269,355 D873E probably benign Het
Dhx30 A G 9: 110,097,096 L149P probably damaging Het
Dtx1 A G 5: 120,710,291 V8A probably benign Het
Enpp3 T A 10: 24,826,180 K91N possibly damaging Het
Fcho1 C T 8: 71,712,068 G523E possibly damaging Het
Foxb2 T C 19: 16,873,394 K83E unknown Het
Git2 A G 5: 114,749,560 probably null Het
Gm10024 T C 10: 77,711,505 S17P unknown Het
Greb1l A T 18: 10,542,422 Y1339F probably benign Het
Grhl2 T A 15: 37,270,668 D33E probably damaging Het
Herc4 C A 10: 63,290,521 L551I probably benign Het
Igfn1 T A 1: 135,974,790 T390S probably benign Het
Ighv3-1 T A 12: 113,964,469 H90L probably benign Het
Jag2 G T 12: 112,913,659 Y697* probably null Het
Kif1c T C 11: 70,704,972 V168A probably damaging Het
Lipn T C 19: 34,068,641 W5R probably damaging Het
Mavs G A 2: 131,245,325 A248T probably benign Het
Megf10 G A 18: 57,259,701 G390D probably damaging Het
Mib1 A G 18: 10,793,023 H653R probably benign Het
Mrps9 T G 1: 42,903,377 S332A probably benign Het
Muc5b T C 7: 141,869,333 C4498R possibly damaging Het
Myo15b T A 11: 115,887,917 I1157N possibly damaging Het
Myo9b C T 8: 71,347,807 T1002M probably benign Het
Nav3 T A 10: 109,684,239 M2328L probably benign Het
Olfr186 T C 16: 59,027,290 I206V probably benign Het
Olfr917 T A 9: 38,665,810 E11D probably benign Het
Pawr T C 10: 108,333,279 S155P probably damaging Het
Pcdhb15 G T 18: 37,475,037 V441F probably damaging Het
Plekhg3 A G 12: 76,578,131 D1250G probably benign Het
Ptprs T A 17: 56,435,853 M430L possibly damaging Het
Raly T A 2: 154,861,865 S119T probably damaging Het
Serpinb6a A T 13: 33,925,429 S128T probably benign Het
Slc22a7 A G 17: 46,437,103 F210L probably damaging Het
Speg G T 1: 75,387,800 S275I probably damaging Het
Stk32c C T 7: 139,188,225 D47N unknown Het
Stra6 T G 9: 58,152,539 S594R probably benign Het
Sun2 T C 15: 79,730,316 H295R probably benign Het
Syne1 T C 10: 5,103,667 Q7470R probably damaging Het
Syt14 A T 1: 192,983,818 H259Q unknown Het
Trim50 A G 5: 135,353,683 S130G possibly damaging Het
Tyw1 G A 5: 130,269,224 R202Q probably damaging Het
Wdr18 T C 10: 79,965,320 V189A probably benign Het
Zfat C A 15: 68,187,069 A206S probably damaging Het
Other mutations in Ffar2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01508:Ffar2 APN 7 30819176 missense probably benign 0.00
IGL01655:Ffar2 APN 7 30819587 missense probably damaging 1.00
R1874:Ffar2 UTSW 7 30819414 splice site probably null
R3826:Ffar2 UTSW 7 30820085 missense possibly damaging 0.77
R3827:Ffar2 UTSW 7 30820085 missense possibly damaging 0.77
R3828:Ffar2 UTSW 7 30820085 missense possibly damaging 0.77
R4156:Ffar2 UTSW 7 30819668 missense probably damaging 1.00
R6377:Ffar2 UTSW 7 30819546 missense probably benign 0.00
R6987:Ffar2 UTSW 7 30819683 missense possibly damaging 0.94
R7270:Ffar2 UTSW 7 30819504 missense probably benign 0.00
R7374:Ffar2 UTSW 7 30820040 missense probably damaging 1.00
R7616:Ffar2 UTSW 7 30819932 missense probably damaging 1.00
R7784:Ffar2 UTSW 7 30819258 missense probably benign 0.01
R8494:Ffar2 UTSW 7 30819739 nonsense probably null
R9371:Ffar2 UTSW 7 30819504 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCAAGTGGTTCTGCTGAGC -3'
(R):5'- ACAACATGTCCCACCTGGTG -3'

Sequencing Primer
(F):5'- TCTGCTGAGCTGAGAGGGC -3'
(R):5'- GTTCTACCTGAGGCAGAGC -3'
Posted On 2021-12-30