Incidental Mutation 'R9117:Stk32c'
ID 692593
Institutional Source Beutler Lab
Gene Symbol Stk32c
Ensembl Gene ENSMUSG00000015981
Gene Name serine/threonine kinase 32C
Synonyms Pkek, YANK3
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9117 (G1)
Quality Score 186.009
Status Validated
Chromosome 7
Chromosomal Location 138683554-138793223 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 138768141 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Asparagine at position 47 (D47N)
Ref Sequence ENSEMBL: ENSMUSP00000016125 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016125] [ENSMUST00000165870]
AlphaFold Q8QZV4
Predicted Effect unknown
Transcript: ENSMUST00000016125
AA Change: D47N
SMART Domains Protein: ENSMUSP00000016125
Gene: ENSMUSG00000015981
AA Change: D47N

DomainStartEndE-ValueType
low complexity region 2 29 N/A INTRINSIC
low complexity region 32 48 N/A INTRINSIC
low complexity region 62 80 N/A INTRINSIC
S_TKc 94 354 9.16e-82 SMART
low complexity region 398 407 N/A INTRINSIC
low complexity region 408 418 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000165870
SMART Domains Protein: ENSMUSP00000126638
Gene: ENSMUSG00000015981

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 1 232 1.2e-30 PFAM
Pfam:Pkinase 1 235 1.5e-51 PFAM
Pfam:Kinase-like 12 223 6.2e-13 PFAM
low complexity region 280 289 N/A INTRINSIC
low complexity region 290 300 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 98% (56/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the serine/threonine protein kinase family. It is thought that this family member is functional in brain due to its high expression levels there. DNA methylation differences have been found in this gene in monozygotic twins that are discordant for adolescent depression. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310061I04Rik C G 17: 36,203,963 (GRCm39) S185T probably benign Het
Agfg1 T G 1: 82,872,216 (GRCm39) F516L possibly damaging Het
Akap5 T A 12: 76,374,592 (GRCm39) M8K possibly damaging Het
Aldh1l2 C T 10: 83,342,545 (GRCm39) V535I probably benign Het
Atg3 T C 16: 45,006,564 (GRCm39) V277A probably damaging Het
Bloc1s6 C T 2: 122,588,534 (GRCm39) P168L probably damaging Het
Ccr7 A G 11: 99,036,086 (GRCm39) Y279H probably damaging Het
Cfap210 G T 2: 69,612,103 (GRCm39) S175* probably null Het
Clint1 A G 11: 45,781,562 (GRCm39) T211A probably damaging Het
Dchs2 T G 3: 83,176,662 (GRCm39) D873E probably benign Het
Dhx30 A G 9: 109,926,164 (GRCm39) L149P probably damaging Het
Dnah1 T C 14: 31,033,581 (GRCm39) probably benign Het
Dtx1 A G 5: 120,848,356 (GRCm39) V8A probably benign Het
Enpp3 T A 10: 24,702,078 (GRCm39) K91N possibly damaging Het
Fcho1 C T 8: 72,164,712 (GRCm39) G523E possibly damaging Het
Ffar2 T C 7: 30,518,616 (GRCm39) E308G probably damaging Het
Foxb2 T C 19: 16,850,758 (GRCm39) K83E unknown Het
Git2 A G 5: 114,887,621 (GRCm39) probably null Het
Gm10024 T C 10: 77,547,339 (GRCm39) S17P unknown Het
Greb1l A T 18: 10,542,422 (GRCm39) Y1339F probably benign Het
Grhl2 T A 15: 37,270,912 (GRCm39) D33E probably damaging Het
Herc4 C A 10: 63,126,300 (GRCm39) L551I probably benign Het
Igfn1 T A 1: 135,902,528 (GRCm39) T390S probably benign Het
Ighv3-1 T A 12: 113,928,089 (GRCm39) H90L probably benign Het
Jag2 G T 12: 112,877,279 (GRCm39) Y697* probably null Het
Kif1c T C 11: 70,595,798 (GRCm39) V168A probably damaging Het
Lipn T C 19: 34,046,041 (GRCm39) W5R probably damaging Het
Mavs G A 2: 131,087,245 (GRCm39) A248T probably benign Het
Megf10 G A 18: 57,392,773 (GRCm39) G390D probably damaging Het
Mib1 A G 18: 10,793,023 (GRCm39) H653R probably benign Het
Mrps9 T G 1: 42,942,537 (GRCm39) S332A probably benign Het
Muc5b T C 7: 141,423,070 (GRCm39) C4498R possibly damaging Het
Myo15b T A 11: 115,778,743 (GRCm39) I1157N possibly damaging Het
Myo9b C T 8: 71,800,451 (GRCm39) T1002M probably benign Het
Nav3 T A 10: 109,520,100 (GRCm39) M2328L probably benign Het
Or5h18 T C 16: 58,847,653 (GRCm39) I206V probably benign Het
Or8b52 T A 9: 38,577,106 (GRCm39) E11D probably benign Het
Pawr T C 10: 108,169,140 (GRCm39) S155P probably damaging Het
Pcdhb15 G T 18: 37,608,090 (GRCm39) V441F probably damaging Het
Plekhg3 A G 12: 76,624,905 (GRCm39) D1250G probably benign Het
Ptprs T A 17: 56,742,853 (GRCm39) M430L possibly damaging Het
Raly T A 2: 154,703,785 (GRCm39) S119T probably damaging Het
Serpinb6a A T 13: 34,109,412 (GRCm39) S128T probably benign Het
Sirt3 C T 7: 140,449,362 (GRCm39) probably benign Het
Slc22a7 A G 17: 46,748,029 (GRCm39) F210L probably damaging Het
Speg G T 1: 75,364,444 (GRCm39) S275I probably damaging Het
Stra6 T G 9: 58,059,822 (GRCm39) S594R probably benign Het
Sun2 T C 15: 79,614,517 (GRCm39) H295R probably benign Het
Syne1 T C 10: 5,053,667 (GRCm39) Q7470R probably damaging Het
Syt14 A T 1: 192,666,126 (GRCm39) H259Q unknown Het
Toporsl A T 4: 52,609,943 (GRCm39) probably benign Het
Trim50 A G 5: 135,382,537 (GRCm39) S130G possibly damaging Het
Tyw1 G A 5: 130,298,065 (GRCm39) R202Q probably damaging Het
Wdr18 T C 10: 79,801,154 (GRCm39) V189A probably benign Het
Zfat C A 15: 68,058,918 (GRCm39) A206S probably damaging Het
Other mutations in Stk32c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02003:Stk32c APN 7 138,768,069 (GRCm39) missense possibly damaging 0.47
IGL02559:Stk32c APN 7 138,700,606 (GRCm39) missense probably benign 0.00
IGL02805:Stk32c APN 7 138,701,762 (GRCm39) missense probably damaging 1.00
R0531:Stk32c UTSW 7 138,700,636 (GRCm39) missense probably damaging 0.97
R0622:Stk32c UTSW 7 138,768,026 (GRCm39) missense probably benign 0.00
R1140:Stk32c UTSW 7 138,705,095 (GRCm39) missense probably damaging 0.99
R1473:Stk32c UTSW 7 138,705,095 (GRCm39) missense probably damaging 0.99
R1589:Stk32c UTSW 7 138,698,931 (GRCm39) critical splice donor site probably null
R1697:Stk32c UTSW 7 138,701,740 (GRCm39) missense probably benign 0.25
R1855:Stk32c UTSW 7 138,701,363 (GRCm39) missense probably damaging 0.97
R4290:Stk32c UTSW 7 138,700,704 (GRCm39) critical splice acceptor site probably null
R4293:Stk32c UTSW 7 138,700,704 (GRCm39) critical splice acceptor site probably null
R4295:Stk32c UTSW 7 138,700,704 (GRCm39) critical splice acceptor site probably null
R5323:Stk32c UTSW 7 138,699,276 (GRCm39) missense probably benign 0.07
R5854:Stk32c UTSW 7 138,768,195 (GRCm39) intron probably benign
R5907:Stk32c UTSW 7 138,700,590 (GRCm39) missense probably benign 0.32
R6115:Stk32c UTSW 7 138,700,628 (GRCm39) nonsense probably null
R6117:Stk32c UTSW 7 138,702,839 (GRCm39) nonsense probably null
R6176:Stk32c UTSW 7 138,700,691 (GRCm39) missense probably benign 0.02
R6460:Stk32c UTSW 7 138,685,190 (GRCm39) missense probably damaging 1.00
R6695:Stk32c UTSW 7 138,702,880 (GRCm39) missense probably damaging 1.00
R6745:Stk32c UTSW 7 138,702,809 (GRCm39) missense probably damaging 0.99
R7177:Stk32c UTSW 7 138,684,218 (GRCm39) missense possibly damaging 0.62
R7676:Stk32c UTSW 7 138,685,220 (GRCm39) missense possibly damaging 0.87
R7721:Stk32c UTSW 7 138,768,069 (GRCm39) missense possibly damaging 0.47
R8977:Stk32c UTSW 7 138,705,161 (GRCm39) missense possibly damaging 0.69
R9004:Stk32c UTSW 7 138,702,859 (GRCm39) missense probably damaging 1.00
R9481:Stk32c UTSW 7 138,768,173 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- GTCCCAACGCAGAGAAATGC -3'
(R):5'- AACTAGACCCTTTTCCGCGG -3'

Sequencing Primer
(F):5'- TCTCCAGAGGCCCGGGTAC -3'
(R):5'- TGCTGCGCACGGAATCTAATAC -3'
Posted On 2021-12-30