Mutagenetix > Incidental Mutation

Incidental Mutation 'R9117:Enpp3'

692601

Institutional Source

Beutler Lab

Gene Symbol

Enpp3

Ensembl Gene

ENSMUSG00000019989

Gene Name

ectonucleotide pyrophosphatase/phosphodiesterase 3

Synonyms

CD203c

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.136) question?

Stock #

R9117 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

24772406-24842823 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 24826180 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Asparagine at position 91 (K91N)

Ref Sequence

ENSEMBL: ENSMUSP00000020169 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020169] [ENSMUST00000217903] [ENSMUST00000218044] [ENSMUST00000219342] [ENSMUST00000219968] [ENSMUST00000220209]

AlphaFold

Q6DYE8

Predicted Effect

possibly damaging
Transcript: ENSMUST00000020169
AA Change: K91N

PolyPhen 2 Score 0.667 (Sensitivity: 0.86; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000020169
Gene: ENSMUSG00000019989
AA Change: K91N

Domain	Start	End	E-Value	Type
transmembrane domain	23	45	N/A	INTRINSIC
SO	50	93	1.99e-13	SMART
SO	94	137	7.66e-15	SMART
Pfam:Phosphodiest	161	485	1.7e-87	PFAM
Blast:Endonuclease_NS	543	599	9e-15	BLAST
Endonuclease_NS	626	847	5.41e-16	SMART
NUC	627	856	1.54e-92	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000217903
AA Change: K65N

PolyPhen 2 Score 0.910 (Sensitivity: 0.81; Specificity: 0.94)

Predicted Effect

possibly damaging
Transcript: ENSMUST00000218044
AA Change: K91N

PolyPhen 2 Score 0.748 (Sensitivity: 0.85; Specificity: 0.92)

Predicted Effect

probably benign
Transcript: ENSMUST00000219342

Predicted Effect

probably benign
Transcript: ENSMUST00000219968

Predicted Effect

probably benign
Transcript: ENSMUST00000220209

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

98% (56/57)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to a series of ectoenzymes that are involved in hydrolysis of extracellular nucleotides. These ectoenzymes possess ATPase and ATP pyrophosphatase activities and are type II transmembrane proteins. Expression of the related rat mRNA has been found in a subset of immature glial cells and in the alimentary tract. The corresponding rat protein has been detected in the pancreas, small intestine, colon, and liver. The human mRNA is expressed in glioma cells, prostate, and uterus. Expression of the human protein has been detected in uterus, basophils, and mast cells. Two transcript variants, one protein coding and the other non-protein coding, have been found for this gene. [provided by RefSeq, Oct 2015]
PHENOTYPE: Mice homozygous for a knockout allele exhibit increased numbers of basophils and mast cells with increased susceptibility to chronic allergic responses. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310061I04Rik	C	G	17: 35,893,071	S185T	probably benign	Het
Agfg1	T	G	1: 82,894,495	F516L	possibly damaging	Het
Akap5	T	A	12: 76,327,818	M8K	possibly damaging	Het
Aldh1l2	C	T	10: 83,506,681	V535I	probably benign	Het
Atg3	T	C	16: 45,186,201	V277A	probably damaging	Het
Bloc1s6	C	T	2: 122,746,614	P168L	probably damaging	Het
Ccdc173	G	T	2: 69,781,759	S175*	probably null	Het
Ccr7	A	G	11: 99,145,260	Y279H	probably damaging	Het
Clint1	A	G	11: 45,890,735	T211A	probably damaging	Het
Dchs2	T	G	3: 83,269,355	D873E	probably benign	Het
Dhx30	A	G	9: 110,097,096	L149P	probably damaging	Het
Dnah1	T	C	14: 31,311,624		probably benign	Het
Dtx1	A	G	5: 120,710,291	V8A	probably benign	Het
Fcho1	C	T	8: 71,712,068	G523E	possibly damaging	Het
Ffar2	T	C	7: 30,819,191	E308G	probably damaging	Het
Foxb2	T	C	19: 16,873,394	K83E	unknown	Het
Git2	A	G	5: 114,749,560		probably null	Het
Gm10024	T	C	10: 77,711,505	S17P	unknown	Het
Greb1l	A	T	18: 10,542,422	Y1339F	probably benign	Het
Grhl2	T	A	15: 37,270,668	D33E	probably damaging	Het
Herc4	C	A	10: 63,290,521	L551I	probably benign	Het
Igfn1	T	A	1: 135,974,790	T390S	probably benign	Het
Ighv3-1	T	A	12: 113,964,469	H90L	probably benign	Het
Jag2	G	T	12: 112,913,659	Y697*	probably null	Het
Kif1c	T	C	11: 70,704,972	V168A	probably damaging	Het
Lipn	T	C	19: 34,068,641	W5R	probably damaging	Het
Mavs	G	A	2: 131,245,325	A248T	probably benign	Het
Megf10	G	A	18: 57,259,701	G390D	probably damaging	Het
Mib1	A	G	18: 10,793,023	H653R	probably benign	Het
Mrps9	T	G	1: 42,903,377	S332A	probably benign	Het
Muc5b	T	C	7: 141,869,333	C4498R	possibly damaging	Het
Myo15b	T	A	11: 115,887,917	I1157N	possibly damaging	Het
Myo9b	C	T	8: 71,347,807	T1002M	probably benign	Het
Nav3	T	A	10: 109,684,239	M2328L	probably benign	Het
Olfr186	T	C	16: 59,027,290	I206V	probably benign	Het
Olfr917	T	A	9: 38,665,810	E11D	probably benign	Het
Pawr	T	C	10: 108,333,279	S155P	probably damaging	Het
Pcdhb15	G	T	18: 37,475,037	V441F	probably damaging	Het
Plekhg3	A	G	12: 76,578,131	D1250G	probably benign	Het
Ptprs	T	A	17: 56,435,853	M430L	possibly damaging	Het
Raly	T	A	2: 154,861,865	S119T	probably damaging	Het
Serpinb6a	A	T	13: 33,925,429	S128T	probably benign	Het
Sirt3	C	T	7: 140,869,449		probably benign	Het
Slc22a7	A	G	17: 46,437,103	F210L	probably damaging	Het
Speg	G	T	1: 75,387,800	S275I	probably damaging	Het
Stk32c	C	T	7: 139,188,225	D47N	unknown	Het
Stra6	T	G	9: 58,152,539	S594R	probably benign	Het
Sun2	T	C	15: 79,730,316	H295R	probably benign	Het
Syne1	T	C	10: 5,103,667	Q7470R	probably damaging	Het
Syt14	A	T	1: 192,983,818	H259Q	unknown	Het
Toporsl	A	T	4: 52,609,943		probably benign	Het
Trim50	A	G	5: 135,353,683	S130G	possibly damaging	Het
Tyw1	G	A	5: 130,269,224	R202Q	probably damaging	Het
Wdr18	T	C	10: 79,965,320	V189A	probably benign	Het
Zfat	C	A	15: 68,187,069	A206S	probably damaging	Het

Other mutations in Enpp3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00519:Enpp3	APN	10	24787772	missense	probably benign	0.00
IGL00778:Enpp3	APN	10	24798262	missense	probably damaging	1.00
IGL01147:Enpp3	APN	10	24774907	missense	probably damaging	1.00
IGL01343:Enpp3	APN	10	24805922	nonsense	probably null
IGL01642:Enpp3	APN	10	24798269	missense	probably damaging	1.00
IGL01814:Enpp3	APN	10	24792025	missense	possibly damaging	0.68
IGL02083:Enpp3	APN	10	24776794	missense	probably damaging	1.00
IGL02152:Enpp3	APN	10	24774002	missense	probably damaging	1.00
IGL02186:Enpp3	APN	10	24791983	splice site	probably benign
IGL02517:Enpp3	APN	10	24809848	splice site	probably benign
IGL02956:Enpp3	APN	10	24774943	splice site	probably benign
R0017:Enpp3	UTSW	10	24799153	splice site	probably null
R0042:Enpp3	UTSW	10	24774824	missense	probably damaging	1.00
R0110:Enpp3	UTSW	10	24776781	missense	probably damaging	1.00
R0218:Enpp3	UTSW	10	24776869	missense	possibly damaging	0.80
R0403:Enpp3	UTSW	10	24804436	missense	probably damaging	1.00
R0433:Enpp3	UTSW	10	24820597	missense	probably benign	0.00
R0450:Enpp3	UTSW	10	24776781	missense	probably damaging	1.00
R0510:Enpp3	UTSW	10	24776781	missense	probably damaging	1.00
R0826:Enpp3	UTSW	10	24795716	missense	probably damaging	1.00
R1245:Enpp3	UTSW	10	24784953	splice site	probably benign
R1261:Enpp3	UTSW	10	24774934	missense	probably damaging	0.97
R1633:Enpp3	UTSW	10	24795782	missense	probably damaging	1.00
R1903:Enpp3	UTSW	10	24778789	missense	probably damaging	1.00
R1913:Enpp3	UTSW	10	24776771	nonsense	probably null
R1966:Enpp3	UTSW	10	24807491	missense	probably damaging	0.99
R2157:Enpp3	UTSW	10	24776878	missense	probably damaging	1.00
R2179:Enpp3	UTSW	10	24805895	missense	probably benign	0.00
R2380:Enpp3	UTSW	10	24776872	missense	probably benign
R2410:Enpp3	UTSW	10	24774818	missense	probably benign	0.00
R3794:Enpp3	UTSW	10	24831732	splice site	probably null
R3896:Enpp3	UTSW	10	24777949	missense	possibly damaging	0.79
R4334:Enpp3	UTSW	10	24793589	missense	probably damaging	1.00
R4569:Enpp3	UTSW	10	24776882	missense	probably damaging	1.00
R4766:Enpp3	UTSW	10	24773927	missense	probably damaging	1.00
R4951:Enpp3	UTSW	10	24798277	missense	probably damaging	1.00
R4998:Enpp3	UTSW	10	24807538	missense	probably benign	0.01
R5045:Enpp3	UTSW	10	24776767	missense	probably damaging	1.00
R5276:Enpp3	UTSW	10	24809916	missense	probably damaging	1.00
R5331:Enpp3	UTSW	10	24808160	missense	probably damaging	1.00
R5569:Enpp3	UTSW	10	24778821	missense	probably damaging	0.98
R5975:Enpp3	UTSW	10	24774842	missense	probably benign	0.37
R6117:Enpp3	UTSW	10	24787852	missense	probably damaging	1.00
R6419:Enpp3	UTSW	10	24808191	missense	probably damaging	1.00
R6677:Enpp3	UTSW	10	24777957	missense	possibly damaging	0.88
R6735:Enpp3	UTSW	10	24807453	missense	probably damaging	1.00
R6833:Enpp3	UTSW	10	24809870	missense	probably damaging	1.00
R6999:Enpp3	UTSW	10	24808166	missense	probably damaging	1.00
R7022:Enpp3	UTSW	10	24826195	missense	probably damaging	0.99
R7173:Enpp3	UTSW	10	24774047	missense	probably damaging	1.00
R7224:Enpp3	UTSW	10	24776884	missense	possibly damaging	0.63
R7227:Enpp3	UTSW	10	24817844	missense	unknown
R7487:Enpp3	UTSW	10	24805923	missense	probably benign	0.02
R7529:Enpp3	UTSW	10	24798174	missense	probably damaging	0.97
R7583:Enpp3	UTSW	10	24836092	start codon destroyed	probably null	0.83
R7692:Enpp3	UTSW	10	24784841	nonsense	probably null
R7962:Enpp3	UTSW	10	24784854	missense	probably damaging	1.00
R7965:Enpp3	UTSW	10	24778819	missense	possibly damaging	0.90
R8153:Enpp3	UTSW	10	24809879	missense	probably damaging	1.00
R8262:Enpp3	UTSW	10	24777926	missense	probably damaging	1.00
R8305:Enpp3	UTSW	10	24824929	critical splice acceptor site	probably null
R8393:Enpp3	UTSW	10	24826241	missense	probably damaging	1.00
R8776:Enpp3	UTSW	10	24774835	missense	probably damaging	1.00
R8776-TAIL:Enpp3	UTSW	10	24774835	missense	probably damaging	1.00
R8962:Enpp3	UTSW	10	24820615	missense	probably benign	0.12
R9047:Enpp3	UTSW	10	24798274	missense	possibly damaging	0.83
R9093:Enpp3	UTSW	10	24795804	missense	probably benign	0.00
R9194:Enpp3	UTSW	10	24799194	missense	possibly damaging	0.90
R9224:Enpp3	UTSW	10	24774818	missense	probably benign	0.00
R9244:Enpp3	UTSW	10	24778791	missense	probably damaging	1.00
R9387:Enpp3	UTSW	10	24836092	start codon destroyed	probably null	0.83
R9644:Enpp3	UTSW	10	24809903	missense	probably damaging	0.98
R9658:Enpp3	UTSW	10	24773904	makesense	probably null
X0026:Enpp3	UTSW	10	24826242	missense	probably damaging	1.00
Z1176:Enpp3	UTSW	10	24787793	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- ACAGATCATGCGACAGTAAAGTTAG -3'
(R):5'- ATGAAGCACTGGCCAACTTC -3'

Sequencing Primer
(F):5'- CTGCCAACACGTAGATGTTG -3'
(R):5'- GAAGCACTGGCCAACTTCTTAGTG -3'

Posted On

2021-12-30