Incidental Mutation 'R9117:Enpp3'
ID 692601
Institutional Source Beutler Lab
Gene Symbol Enpp3
Ensembl Gene ENSMUSG00000019989
Gene Name ectonucleotide pyrophosphatase/phosphodiesterase 3
Synonyms CD203c
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.151) question?
Stock # R9117 (G1)
Quality Score 225.009
Status Not validated
Chromosome 10
Chromosomal Location 24772406-24842823 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 24826180 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Asparagine at position 91 (K91N)
Ref Sequence ENSEMBL: ENSMUSP00000020169 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020169] [ENSMUST00000217903] [ENSMUST00000218044] [ENSMUST00000219342] [ENSMUST00000219968] [ENSMUST00000220209]
AlphaFold Q6DYE8
Predicted Effect possibly damaging
Transcript: ENSMUST00000020169
AA Change: K91N

PolyPhen 2 Score 0.667 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000020169
Gene: ENSMUSG00000019989
AA Change: K91N

DomainStartEndE-ValueType
transmembrane domain 23 45 N/A INTRINSIC
SO 50 93 1.99e-13 SMART
SO 94 137 7.66e-15 SMART
Pfam:Phosphodiest 161 485 1.7e-87 PFAM
Blast:Endonuclease_NS 543 599 9e-15 BLAST
Endonuclease_NS 626 847 5.41e-16 SMART
NUC 627 856 1.54e-92 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000217903
AA Change: K65N

PolyPhen 2 Score 0.910 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000218044
AA Change: K91N

PolyPhen 2 Score 0.748 (Sensitivity: 0.85; Specificity: 0.92)
Predicted Effect probably benign
Transcript: ENSMUST00000219342
Predicted Effect probably benign
Transcript: ENSMUST00000219968
Predicted Effect probably benign
Transcript: ENSMUST00000220209
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to a series of ectoenzymes that are involved in hydrolysis of extracellular nucleotides. These ectoenzymes possess ATPase and ATP pyrophosphatase activities and are type II transmembrane proteins. Expression of the related rat mRNA has been found in a subset of immature glial cells and in the alimentary tract. The corresponding rat protein has been detected in the pancreas, small intestine, colon, and liver. The human mRNA is expressed in glioma cells, prostate, and uterus. Expression of the human protein has been detected in uterus, basophils, and mast cells. Two transcript variants, one protein coding and the other non-protein coding, have been found for this gene. [provided by RefSeq, Oct 2015]
PHENOTYPE: Mice homozygous for a knockout allele exhibit increased numbers of basophils and mast cells with increased susceptibility to chronic allergic responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310061I04Rik C G 17: 35,893,071 S185T probably benign Het
Agfg1 T G 1: 82,894,495 F516L possibly damaging Het
Akap5 T A 12: 76,327,818 M8K possibly damaging Het
Aldh1l2 C T 10: 83,506,681 V535I probably benign Het
Atg3 T C 16: 45,186,201 V277A probably damaging Het
Bloc1s6 C T 2: 122,746,614 P168L probably damaging Het
Ccdc173 G T 2: 69,781,759 S175* probably null Het
Ccr7 A G 11: 99,145,260 Y279H probably damaging Het
Clint1 A G 11: 45,890,735 T211A probably damaging Het
Dchs2 T G 3: 83,269,355 D873E probably benign Het
Dhx30 A G 9: 110,097,096 L149P probably damaging Het
Dtx1 A G 5: 120,710,291 V8A probably benign Het
Fcho1 C T 8: 71,712,068 G523E possibly damaging Het
Ffar2 T C 7: 30,819,191 E308G probably damaging Het
Foxb2 T C 19: 16,873,394 K83E unknown Het
Git2 A G 5: 114,749,560 probably null Het
Gm10024 T C 10: 77,711,505 S17P unknown Het
Greb1l A T 18: 10,542,422 Y1339F probably benign Het
Grhl2 T A 15: 37,270,668 D33E probably damaging Het
Herc4 C A 10: 63,290,521 L551I probably benign Het
Igfn1 T A 1: 135,974,790 T390S probably benign Het
Ighv3-1 T A 12: 113,964,469 H90L probably benign Het
Jag2 G T 12: 112,913,659 Y697* probably null Het
Kif1c T C 11: 70,704,972 V168A probably damaging Het
Lipn T C 19: 34,068,641 W5R probably damaging Het
Mavs G A 2: 131,245,325 A248T probably benign Het
Megf10 G A 18: 57,259,701 G390D probably damaging Het
Mib1 A G 18: 10,793,023 H653R probably benign Het
Mrps9 T G 1: 42,903,377 S332A probably benign Het
Muc5b T C 7: 141,869,333 C4498R possibly damaging Het
Myo15b T A 11: 115,887,917 I1157N possibly damaging Het
Myo9b C T 8: 71,347,807 T1002M probably benign Het
Nav3 T A 10: 109,684,239 M2328L probably benign Het
Olfr186 T C 16: 59,027,290 I206V probably benign Het
Olfr917 T A 9: 38,665,810 E11D probably benign Het
Pawr T C 10: 108,333,279 S155P probably damaging Het
Pcdhb15 G T 18: 37,475,037 V441F probably damaging Het
Plekhg3 A G 12: 76,578,131 D1250G probably benign Het
Ptprs T A 17: 56,435,853 M430L possibly damaging Het
Raly T A 2: 154,861,865 S119T probably damaging Het
Serpinb6a A T 13: 33,925,429 S128T probably benign Het
Slc22a7 A G 17: 46,437,103 F210L probably damaging Het
Speg G T 1: 75,387,800 S275I probably damaging Het
Stk32c C T 7: 139,188,225 D47N unknown Het
Stra6 T G 9: 58,152,539 S594R probably benign Het
Sun2 T C 15: 79,730,316 H295R probably benign Het
Syne1 T C 10: 5,103,667 Q7470R probably damaging Het
Syt14 A T 1: 192,983,818 H259Q unknown Het
Trim50 A G 5: 135,353,683 S130G possibly damaging Het
Tyw1 G A 5: 130,269,224 R202Q probably damaging Het
Wdr18 T C 10: 79,965,320 V189A probably benign Het
Zfat C A 15: 68,187,069 A206S probably damaging Het
Other mutations in Enpp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00519:Enpp3 APN 10 24787772 missense probably benign 0.00
IGL00778:Enpp3 APN 10 24798262 missense probably damaging 1.00
IGL01147:Enpp3 APN 10 24774907 missense probably damaging 1.00
IGL01343:Enpp3 APN 10 24805922 nonsense probably null
IGL01642:Enpp3 APN 10 24798269 missense probably damaging 1.00
IGL01814:Enpp3 APN 10 24792025 missense possibly damaging 0.68
IGL02083:Enpp3 APN 10 24776794 missense probably damaging 1.00
IGL02152:Enpp3 APN 10 24774002 missense probably damaging 1.00
IGL02186:Enpp3 APN 10 24791983 splice site probably benign
IGL02517:Enpp3 APN 10 24809848 splice site probably benign
IGL02956:Enpp3 APN 10 24774943 splice site probably benign
R0017:Enpp3 UTSW 10 24799153 splice site probably null
R0042:Enpp3 UTSW 10 24774824 missense probably damaging 1.00
R0110:Enpp3 UTSW 10 24776781 missense probably damaging 1.00
R0218:Enpp3 UTSW 10 24776869 missense possibly damaging 0.80
R0403:Enpp3 UTSW 10 24804436 missense probably damaging 1.00
R0433:Enpp3 UTSW 10 24820597 missense probably benign 0.00
R0450:Enpp3 UTSW 10 24776781 missense probably damaging 1.00
R0510:Enpp3 UTSW 10 24776781 missense probably damaging 1.00
R0826:Enpp3 UTSW 10 24795716 missense probably damaging 1.00
R1245:Enpp3 UTSW 10 24784953 splice site probably benign
R1261:Enpp3 UTSW 10 24774934 missense probably damaging 0.97
R1633:Enpp3 UTSW 10 24795782 missense probably damaging 1.00
R1903:Enpp3 UTSW 10 24778789 missense probably damaging 1.00
R1913:Enpp3 UTSW 10 24776771 nonsense probably null
R1966:Enpp3 UTSW 10 24807491 missense probably damaging 0.99
R2157:Enpp3 UTSW 10 24776878 missense probably damaging 1.00
R2179:Enpp3 UTSW 10 24805895 missense probably benign 0.00
R2380:Enpp3 UTSW 10 24776872 missense probably benign
R2410:Enpp3 UTSW 10 24774818 missense probably benign 0.00
R3794:Enpp3 UTSW 10 24831732 splice site probably null
R3896:Enpp3 UTSW 10 24777949 missense possibly damaging 0.79
R4334:Enpp3 UTSW 10 24793589 missense probably damaging 1.00
R4569:Enpp3 UTSW 10 24776882 missense probably damaging 1.00
R4766:Enpp3 UTSW 10 24773927 missense probably damaging 1.00
R4951:Enpp3 UTSW 10 24798277 missense probably damaging 1.00
R4998:Enpp3 UTSW 10 24807538 missense probably benign 0.01
R5045:Enpp3 UTSW 10 24776767 missense probably damaging 1.00
R5276:Enpp3 UTSW 10 24809916 missense probably damaging 1.00
R5331:Enpp3 UTSW 10 24808160 missense probably damaging 1.00
R5569:Enpp3 UTSW 10 24778821 missense probably damaging 0.98
R5975:Enpp3 UTSW 10 24774842 missense probably benign 0.37
R6117:Enpp3 UTSW 10 24787852 missense probably damaging 1.00
R6419:Enpp3 UTSW 10 24808191 missense probably damaging 1.00
R6677:Enpp3 UTSW 10 24777957 missense possibly damaging 0.88
R6735:Enpp3 UTSW 10 24807453 missense probably damaging 1.00
R6833:Enpp3 UTSW 10 24809870 missense probably damaging 1.00
R6999:Enpp3 UTSW 10 24808166 missense probably damaging 1.00
R7022:Enpp3 UTSW 10 24826195 missense probably damaging 0.99
R7173:Enpp3 UTSW 10 24774047 missense probably damaging 1.00
R7224:Enpp3 UTSW 10 24776884 missense possibly damaging 0.63
R7227:Enpp3 UTSW 10 24817844 missense unknown
R7487:Enpp3 UTSW 10 24805923 missense probably benign 0.02
R7529:Enpp3 UTSW 10 24798174 missense probably damaging 0.97
R7583:Enpp3 UTSW 10 24836092 start codon destroyed probably null 0.83
R7692:Enpp3 UTSW 10 24784841 nonsense probably null
R7962:Enpp3 UTSW 10 24784854 missense probably damaging 1.00
R7965:Enpp3 UTSW 10 24778819 missense possibly damaging 0.90
R8153:Enpp3 UTSW 10 24809879 missense probably damaging 1.00
R8262:Enpp3 UTSW 10 24777926 missense probably damaging 1.00
R8305:Enpp3 UTSW 10 24824929 critical splice acceptor site probably null
R8393:Enpp3 UTSW 10 24826241 missense probably damaging 1.00
R8776:Enpp3 UTSW 10 24774835 missense probably damaging 1.00
R8776-TAIL:Enpp3 UTSW 10 24774835 missense probably damaging 1.00
R8962:Enpp3 UTSW 10 24820615 missense probably benign 0.12
R9047:Enpp3 UTSW 10 24798274 missense possibly damaging 0.83
R9093:Enpp3 UTSW 10 24795804 missense probably benign 0.00
R9194:Enpp3 UTSW 10 24799194 missense possibly damaging 0.90
R9224:Enpp3 UTSW 10 24774818 missense probably benign 0.00
R9244:Enpp3 UTSW 10 24778791 missense probably damaging 1.00
R9387:Enpp3 UTSW 10 24836092 start codon destroyed probably null 0.83
X0026:Enpp3 UTSW 10 24826242 missense probably damaging 1.00
Z1176:Enpp3 UTSW 10 24787793 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACAGATCATGCGACAGTAAAGTTAG -3'
(R):5'- ATGAAGCACTGGCCAACTTC -3'

Sequencing Primer
(F):5'- CTGCCAACACGTAGATGTTG -3'
(R):5'- GAAGCACTGGCCAACTTCTTAGTG -3'
Posted On 2021-12-30