Incidental Mutation 'R9117:Aldh1l2'
ID 692605
Institutional Source Beutler Lab
Gene Symbol Aldh1l2
Ensembl Gene ENSMUSG00000020256
Gene Name aldehyde dehydrogenase 1 family, member L2
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9117 (G1)
Quality Score 225.009
Status Not validated
Chromosome 10
Chromosomal Location 83487450-83534140 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 83506681 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 535 (V535I)
Ref Sequence ENSEMBL: ENSMUSP00000020497 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020497] [ENSMUST00000146640]
AlphaFold Q8K009
Predicted Effect probably benign
Transcript: ENSMUST00000020497
AA Change: V535I

PolyPhen 2 Score 0.409 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000020497
Gene: ENSMUSG00000020256
AA Change: V535I

DomainStartEndE-ValueType
Pfam:Formyl_trans_N 23 202 5e-46 PFAM
Pfam:Formyl_trans_C 226 330 1.3e-16 PFAM
Pfam:PP-binding 346 412 9.6e-7 PFAM
Pfam:Aldedh 451 919 3.4e-174 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000146640
AA Change: V422I

PolyPhen 2 Score 0.409 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000117076
Gene: ENSMUSG00000020256
AA Change: V422I

DomainStartEndE-ValueType
Pfam:Formyl_trans_N 1 89 2.8e-30 PFAM
Pfam:Formyl_trans_C 113 217 1.1e-16 PFAM
Pfam:PP-binding 233 299 1.5e-8 PFAM
Pfam:Aldedh 338 806 8.5e-175 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of both the aldehyde dehydrogenase superfamily and the formyl transferase superfamily. This member is the mitochondrial form of 10-formyltetrahydrofolate dehydrogenase (FDH), which converts 10-formyltetrahydrofolate to tetrahydrofolate and CO2 in an NADP(+)-dependent reaction, and plays an essential role in the distribution of one-carbon groups between the cytosolic and mitochondrial compartments of the cell. Alternatively spliced transcript variants have been found for this gene.[provided by RefSeq, Oct 2010]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310061I04Rik C G 17: 35,893,071 S185T probably benign Het
Agfg1 T G 1: 82,894,495 F516L possibly damaging Het
Akap5 T A 12: 76,327,818 M8K possibly damaging Het
Atg3 T C 16: 45,186,201 V277A probably damaging Het
Bloc1s6 C T 2: 122,746,614 P168L probably damaging Het
Ccdc173 G T 2: 69,781,759 S175* probably null Het
Ccr7 A G 11: 99,145,260 Y279H probably damaging Het
Clint1 A G 11: 45,890,735 T211A probably damaging Het
Dchs2 T G 3: 83,269,355 D873E probably benign Het
Dhx30 A G 9: 110,097,096 L149P probably damaging Het
Dtx1 A G 5: 120,710,291 V8A probably benign Het
Enpp3 T A 10: 24,826,180 K91N possibly damaging Het
Fcho1 C T 8: 71,712,068 G523E possibly damaging Het
Ffar2 T C 7: 30,819,191 E308G probably damaging Het
Foxb2 T C 19: 16,873,394 K83E unknown Het
Git2 A G 5: 114,749,560 probably null Het
Gm10024 T C 10: 77,711,505 S17P unknown Het
Greb1l A T 18: 10,542,422 Y1339F probably benign Het
Grhl2 T A 15: 37,270,668 D33E probably damaging Het
Herc4 C A 10: 63,290,521 L551I probably benign Het
Igfn1 T A 1: 135,974,790 T390S probably benign Het
Ighv3-1 T A 12: 113,964,469 H90L probably benign Het
Jag2 G T 12: 112,913,659 Y697* probably null Het
Kif1c T C 11: 70,704,972 V168A probably damaging Het
Lipn T C 19: 34,068,641 W5R probably damaging Het
Mavs G A 2: 131,245,325 A248T probably benign Het
Megf10 G A 18: 57,259,701 G390D probably damaging Het
Mib1 A G 18: 10,793,023 H653R probably benign Het
Mrps9 T G 1: 42,903,377 S332A probably benign Het
Muc5b T C 7: 141,869,333 C4498R possibly damaging Het
Myo15b T A 11: 115,887,917 I1157N possibly damaging Het
Myo9b C T 8: 71,347,807 T1002M probably benign Het
Nav3 T A 10: 109,684,239 M2328L probably benign Het
Olfr186 T C 16: 59,027,290 I206V probably benign Het
Olfr917 T A 9: 38,665,810 E11D probably benign Het
Pawr T C 10: 108,333,279 S155P probably damaging Het
Pcdhb15 G T 18: 37,475,037 V441F probably damaging Het
Plekhg3 A G 12: 76,578,131 D1250G probably benign Het
Ptprs T A 17: 56,435,853 M430L possibly damaging Het
Raly T A 2: 154,861,865 S119T probably damaging Het
Serpinb6a A T 13: 33,925,429 S128T probably benign Het
Slc22a7 A G 17: 46,437,103 F210L probably damaging Het
Speg G T 1: 75,387,800 S275I probably damaging Het
Stk32c C T 7: 139,188,225 D47N unknown Het
Stra6 T G 9: 58,152,539 S594R probably benign Het
Sun2 T C 15: 79,730,316 H295R probably benign Het
Syne1 T C 10: 5,103,667 Q7470R probably damaging Het
Syt14 A T 1: 192,983,818 H259Q unknown Het
Trim50 A G 5: 135,353,683 S130G possibly damaging Het
Tyw1 G A 5: 130,269,224 R202Q probably damaging Het
Wdr18 T C 10: 79,965,320 V189A probably benign Het
Zfat C A 15: 68,187,069 A206S probably damaging Het
Other mutations in Aldh1l2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01152:Aldh1l2 APN 10 83522886 nonsense probably null
IGL01154:Aldh1l2 APN 10 83520373 missense probably damaging 1.00
IGL01301:Aldh1l2 APN 10 83522846 missense probably damaging 1.00
IGL01354:Aldh1l2 APN 10 83527376 missense probably damaging 1.00
IGL01364:Aldh1l2 APN 10 83492667 missense probably damaging 1.00
IGL01445:Aldh1l2 APN 10 83520262 splice site probably benign
IGL02179:Aldh1l2 APN 10 83522837 missense probably benign 0.10
IGL02283:Aldh1l2 APN 10 83495895 missense probably benign 0.00
IGL02507:Aldh1l2 APN 10 83492584 nonsense probably null
IGL02727:Aldh1l2 APN 10 83506605 missense probably damaging 1.00
IGL03353:Aldh1l2 APN 10 83522913 missense probably benign 0.17
Hunger_winter UTSW 10 83508013 critical splice donor site probably null
Spartan UTSW 10 83512306 missense possibly damaging 0.93
ANU18:Aldh1l2 UTSW 10 83522846 missense probably damaging 1.00
IGL02984:Aldh1l2 UTSW 10 83527335 missense probably damaging 1.00
R0267:Aldh1l2 UTSW 10 83522687 splice site probably benign
R0302:Aldh1l2 UTSW 10 83520365 missense probably damaging 1.00
R0349:Aldh1l2 UTSW 10 83490614 missense probably damaging 1.00
R0468:Aldh1l2 UTSW 10 83518678 missense probably benign 0.01
R0745:Aldh1l2 UTSW 10 83518630 splice site probably null
R0788:Aldh1l2 UTSW 10 83516164 missense probably damaging 1.00
R1117:Aldh1l2 UTSW 10 83508623 missense probably benign 0.01
R1241:Aldh1l2 UTSW 10 83496025 missense probably benign 0.00
R1420:Aldh1l2 UTSW 10 83495935 missense probably damaging 1.00
R1490:Aldh1l2 UTSW 10 83520370 missense probably damaging 1.00
R1704:Aldh1l2 UTSW 10 83508660 missense probably benign 0.10
R1729:Aldh1l2 UTSW 10 83508082 nonsense probably null
R1893:Aldh1l2 UTSW 10 83492536 missense probably damaging 1.00
R1897:Aldh1l2 UTSW 10 83502525 missense probably damaging 1.00
R2047:Aldh1l2 UTSW 10 83506743 missense probably damaging 1.00
R2290:Aldh1l2 UTSW 10 83527313 missense probably damaging 1.00
R3054:Aldh1l2 UTSW 10 83502472 missense probably benign 0.14
R3055:Aldh1l2 UTSW 10 83502472 missense probably benign 0.14
R4097:Aldh1l2 UTSW 10 83512364 missense probably damaging 0.98
R4162:Aldh1l2 UTSW 10 83506654 missense possibly damaging 0.50
R4295:Aldh1l2 UTSW 10 83495920 missense possibly damaging 0.62
R4296:Aldh1l2 UTSW 10 83522777 missense probably benign 0.34
R4388:Aldh1l2 UTSW 10 83513622 missense probably damaging 1.00
R4809:Aldh1l2 UTSW 10 83506632 missense probably damaging 1.00
R5052:Aldh1l2 UTSW 10 83508692 missense possibly damaging 0.92
R5421:Aldh1l2 UTSW 10 83527407 missense probably damaging 1.00
R5491:Aldh1l2 UTSW 10 83522785 missense probably benign 0.00
R5688:Aldh1l2 UTSW 10 83501925 missense possibly damaging 0.93
R5726:Aldh1l2 UTSW 10 83512306 missense possibly damaging 0.93
R5737:Aldh1l2 UTSW 10 83520325 missense probably damaging 1.00
R5752:Aldh1l2 UTSW 10 83520380 missense probably damaging 1.00
R6113:Aldh1l2 UTSW 10 83508134 nonsense probably null
R6161:Aldh1l2 UTSW 10 83520338 missense probably benign 0.00
R6166:Aldh1l2 UTSW 10 83493424 splice site probably null
R6189:Aldh1l2 UTSW 10 83508013 critical splice donor site probably null
R7357:Aldh1l2 UTSW 10 83514544 missense possibly damaging 0.89
R7394:Aldh1l2 UTSW 10 83502457 missense probably damaging 1.00
R7469:Aldh1l2 UTSW 10 83508105 missense probably damaging 1.00
R7676:Aldh1l2 UTSW 10 83508111 missense probably benign
R7848:Aldh1l2 UTSW 10 83499843 missense probably benign 0.12
R7958:Aldh1l2 UTSW 10 83520338 missense probably benign 0.00
R8311:Aldh1l2 UTSW 10 83490615 missense probably damaging 1.00
R8477:Aldh1l2 UTSW 10 83501921 missense probably damaging 1.00
R8730:Aldh1l2 UTSW 10 83506642 missense possibly damaging 0.94
R8884:Aldh1l2 UTSW 10 83508677 missense probably benign 0.02
R9239:Aldh1l2 UTSW 10 83506632 missense probably damaging 1.00
R9335:Aldh1l2 UTSW 10 83506646 missense probably damaging 0.96
R9368:Aldh1l2 UTSW 10 83495952 nonsense probably null
Z1177:Aldh1l2 UTSW 10 83493480 missense probably damaging 1.00
Z1177:Aldh1l2 UTSW 10 83534005 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGAGGATCTCGAGTTGCTCC -3'
(R):5'- CTAGTCTCTGGATTCTTAGTCCTGG -3'

Sequencing Primer
(F):5'- TGCAAACTCTCAGGGTATCTCAG -3'
(R):5'- GGGTTGGTGCCCTATACAG -3'
Posted On 2021-12-30