Incidental Mutation 'R9117:Jag2'
ID 692614
Institutional Source Beutler Lab
Gene Symbol Jag2
Ensembl Gene ENSMUSG00000002799
Gene Name jagged 2
Synonyms Serh, D12Ggc2e
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9117 (G1)
Quality Score 225.009
Status Not validated
Chromosome 12
Chromosomal Location 112907819-112929776 bp(-) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) G to T at 112913659 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Stop codon at position 697 (Y697*)
Ref Sequence ENSEMBL: ENSMUSP00000075224 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075827]
AlphaFold Q9QYE5
Predicted Effect probably null
Transcript: ENSMUST00000075827
AA Change: Y697*
SMART Domains Protein: ENSMUSP00000075224
Gene: ENSMUSG00000002799
AA Change: Y697*

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:MNNL 26 105 4.2e-31 PFAM
low complexity region 108 123 N/A INTRINSIC
DSL 178 240 1.48e-36 SMART
EGF_like 244 274 7.23e1 SMART
EGF 275 305 4.56e0 SMART
EGF_CA 307 345 8.5e-9 SMART
EGF 350 383 4e-5 SMART
EGF_CA 385 421 5.39e-11 SMART
EGF_CA 423 459 3.51e-10 SMART
EGF_CA 461 496 1.01e-10 SMART
EGF_CA 498 534 1.17e-6 SMART
EGF_CA 536 572 6.35e-8 SMART
EGF 588 634 7.53e-1 SMART
EGF_CA 636 672 2.89e-11 SMART
EGF 677 710 3.68e-4 SMART
EGF 715 748 1.32e-5 SMART
EGF 754 787 1.34e-6 SMART
EGF_CA 789 825 2.58e-8 SMART
EGF_CA 827 863 7.23e-12 SMART
VWC 872 949 1.3e-1 SMART
low complexity region 1002 1035 N/A INTRINSIC
transmembrane domain 1085 1107 N/A INTRINSIC
low complexity region 1109 1119 N/A INTRINSIC
low complexity region 1170 1199 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000223140
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Notch signaling pathway is an intercellular signaling mechanism that is essential for proper embryonic development. Members of the Notch gene family encode transmembrane receptors that are critical for various cell fate decisions. The protein encoded by this gene is one of several ligands that activate Notch and related receptors. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation die perinatally with craniofacial defects, fused digits, and increased numbers of sensory hair cells in the cochlea. Homozygotes for a spontaneous mutation exhibit fused digits and sometimes tail kinks. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310061I04Rik C G 17: 35,893,071 S185T probably benign Het
Agfg1 T G 1: 82,894,495 F516L possibly damaging Het
Akap5 T A 12: 76,327,818 M8K possibly damaging Het
Aldh1l2 C T 10: 83,506,681 V535I probably benign Het
Atg3 T C 16: 45,186,201 V277A probably damaging Het
Bloc1s6 C T 2: 122,746,614 P168L probably damaging Het
Ccdc173 G T 2: 69,781,759 S175* probably null Het
Ccr7 A G 11: 99,145,260 Y279H probably damaging Het
Clint1 A G 11: 45,890,735 T211A probably damaging Het
Dchs2 T G 3: 83,269,355 D873E probably benign Het
Dhx30 A G 9: 110,097,096 L149P probably damaging Het
Dtx1 A G 5: 120,710,291 V8A probably benign Het
Enpp3 T A 10: 24,826,180 K91N possibly damaging Het
Fcho1 C T 8: 71,712,068 G523E possibly damaging Het
Ffar2 T C 7: 30,819,191 E308G probably damaging Het
Foxb2 T C 19: 16,873,394 K83E unknown Het
Git2 A G 5: 114,749,560 probably null Het
Gm10024 T C 10: 77,711,505 S17P unknown Het
Greb1l A T 18: 10,542,422 Y1339F probably benign Het
Grhl2 T A 15: 37,270,668 D33E probably damaging Het
Herc4 C A 10: 63,290,521 L551I probably benign Het
Igfn1 T A 1: 135,974,790 T390S probably benign Het
Ighv3-1 T A 12: 113,964,469 H90L probably benign Het
Kif1c T C 11: 70,704,972 V168A probably damaging Het
Lipn T C 19: 34,068,641 W5R probably damaging Het
Mavs G A 2: 131,245,325 A248T probably benign Het
Megf10 G A 18: 57,259,701 G390D probably damaging Het
Mib1 A G 18: 10,793,023 H653R probably benign Het
Mrps9 T G 1: 42,903,377 S332A probably benign Het
Muc5b T C 7: 141,869,333 C4498R possibly damaging Het
Myo15b T A 11: 115,887,917 I1157N possibly damaging Het
Myo9b C T 8: 71,347,807 T1002M probably benign Het
Nav3 T A 10: 109,684,239 M2328L probably benign Het
Olfr186 T C 16: 59,027,290 I206V probably benign Het
Olfr917 T A 9: 38,665,810 E11D probably benign Het
Pawr T C 10: 108,333,279 S155P probably damaging Het
Pcdhb15 G T 18: 37,475,037 V441F probably damaging Het
Plekhg3 A G 12: 76,578,131 D1250G probably benign Het
Ptprs T A 17: 56,435,853 M430L possibly damaging Het
Raly T A 2: 154,861,865 S119T probably damaging Het
Serpinb6a A T 13: 33,925,429 S128T probably benign Het
Slc22a7 A G 17: 46,437,103 F210L probably damaging Het
Speg G T 1: 75,387,800 S275I probably damaging Het
Stk32c C T 7: 139,188,225 D47N unknown Het
Stra6 T G 9: 58,152,539 S594R probably benign Het
Sun2 T C 15: 79,730,316 H295R probably benign Het
Syne1 T C 10: 5,103,667 Q7470R probably damaging Het
Syt14 A T 1: 192,983,818 H259Q unknown Het
Trim50 A G 5: 135,353,683 S130G possibly damaging Het
Tyw1 G A 5: 130,269,224 R202Q probably damaging Het
Wdr18 T C 10: 79,965,320 V189A probably benign Het
Zfat C A 15: 68,187,069 A206S probably damaging Het
Other mutations in Jag2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00157:Jag2 APN 12 112912718 missense probably benign 0.20
IGL00954:Jag2 APN 12 112920406 missense possibly damaging 0.50
IGL01532:Jag2 APN 12 112914363 missense probably damaging 0.98
IGL01646:Jag2 APN 12 112916349 missense possibly damaging 0.65
IGL02243:Jag2 APN 12 112916345 missense possibly damaging 0.94
IGL02447:Jag2 APN 12 112912612 missense probably damaging 1.00
IGL02458:Jag2 APN 12 112915993 missense probably damaging 0.98
IGL02516:Jag2 APN 12 112910566 missense probably damaging 1.00
IGL02574:Jag2 APN 12 112915511 missense probably benign 0.32
IGL02629:Jag2 APN 12 112914514 splice site probably benign
IGL02873:Jag2 APN 12 112910502 missense probably benign 0.00
IGL03087:Jag2 APN 12 112913948 missense possibly damaging 0.60
Jaguarundi UTSW 12 112915469 critical splice donor site probably null
R0068:Jag2 UTSW 12 112915193 splice site probably benign
R0310:Jag2 UTSW 12 112913377 unclassified probably benign
R0963:Jag2 UTSW 12 112915314 missense probably damaging 1.00
R1188:Jag2 UTSW 12 112920121 nonsense probably null
R1256:Jag2 UTSW 12 112914419 missense possibly damaging 0.50
R1298:Jag2 UTSW 12 112916319 unclassified probably benign
R1317:Jag2 UTSW 12 112914501 missense probably benign
R2079:Jag2 UTSW 12 112920377 missense probably damaging 1.00
R2345:Jag2 UTSW 12 112909064 missense probably damaging 1.00
R4654:Jag2 UTSW 12 112913646 missense probably benign 0.13
R4782:Jag2 UTSW 12 112914249 missense probably benign
R4798:Jag2 UTSW 12 112916632 missense probably benign 0.01
R5242:Jag2 UTSW 12 112916866 missense probably damaging 0.97
R5350:Jag2 UTSW 12 112908922 missense possibly damaging 0.77
R5364:Jag2 UTSW 12 112910534 missense probably damaging 1.00
R6129:Jag2 UTSW 12 112920349 nonsense probably null
R6362:Jag2 UTSW 12 112920122 missense probably damaging 0.97
R6376:Jag2 UTSW 12 112909329 missense probably benign 0.00
R6819:Jag2 UTSW 12 112910541 missense probably damaging 1.00
R6844:Jag2 UTSW 12 112916714 missense probably damaging 1.00
R6968:Jag2 UTSW 12 112914258 missense probably benign 0.10
R7514:Jag2 UTSW 12 112929052 missense probably benign 0.19
R7663:Jag2 UTSW 12 112913666 missense probably damaging 1.00
R7730:Jag2 UTSW 12 112922041 missense probably damaging 1.00
R7754:Jag2 UTSW 12 112915469 critical splice donor site probably null
R7828:Jag2 UTSW 12 112913180 missense probably benign 0.19
R7874:Jag2 UTSW 12 112915946 missense probably damaging 0.99
R8075:Jag2 UTSW 12 112915274 missense probably benign 0.05
R8845:Jag2 UTSW 12 112920094 missense probably damaging 1.00
R8876:Jag2 UTSW 12 112909637 missense probably benign 0.00
R9400:Jag2 UTSW 12 112911988 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ATAGCATGTGCCACCGTTGC -3'
(R):5'- TACATGGGCCTGAAGTCATGG -3'

Sequencing Primer
(F):5'- AGGTGTAGGCGTCACACTG -3'
(R):5'- CCTGAAGTCATGGGGTGGAATCC -3'
Posted On 2021-12-30