Incidental Mutation 'R9117:Megf10'
ID 692628
Institutional Source Beutler Lab
Gene Symbol Megf10
Ensembl Gene ENSMUSG00000024593
Gene Name multiple EGF-like-domains 10
Synonyms LOC240312, 3000002B06Rik
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.237) question?
Stock # R9117 (G1)
Quality Score 225.009
Status Validated
Chromosome 18
Chromosomal Location 57266162-57430539 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 57392773 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glycine to Aspartic acid at position 390 (G390D)
Ref Sequence ENSEMBL: ENSMUSP00000075174 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075770] [ENSMUST00000139892]
AlphaFold Q6DIB5
Predicted Effect probably damaging
Transcript: ENSMUST00000075770
AA Change: G390D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000075174
Gene: ENSMUSG00000024593
AA Change: G390D

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
EGF 108 136 9.41e-2 SMART
EGF_Lam 152 191 3.57e-2 SMART
EGF 190 222 5.79e-2 SMART
EGF 233 265 1.78e-2 SMART
EGF_Lam 281 320 7.58e-6 SMART
EGF 319 351 7.13e-2 SMART
EGF_Lam 368 409 9.05e-4 SMART
EGF 408 440 8.78e-2 SMART
EGF 451 483 2.85e-1 SMART
EGF 494 526 2.02e-1 SMART
EGF_Lam 542 581 1.04e-3 SMART
EGF 580 612 1.91e-2 SMART
EGF 623 657 2.16e1 SMART
EGF 668 700 2.48e-1 SMART
EGF 711 743 2.81e0 SMART
EGF_Lam 759 798 4.16e-3 SMART
EGF 797 829 1.73e0 SMART
transmembrane domain 856 878 N/A INTRINSIC
low complexity region 1014 1026 N/A INTRINSIC
low complexity region 1131 1146 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000139892
AA Change: G390D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000116814
Gene: ENSMUSG00000024593
AA Change: G390D

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
EGF 108 136 9.41e-2 SMART
EGF_Lam 152 191 3.57e-2 SMART
EGF 190 222 5.79e-2 SMART
EGF 233 265 1.78e-2 SMART
EGF_Lam 281 320 7.58e-6 SMART
EGF 319 351 7.13e-2 SMART
EGF_Lam 368 409 9.05e-4 SMART
EGF 408 440 8.78e-2 SMART
EGF 451 483 2.85e-1 SMART
EGF 494 526 2.02e-1 SMART
EGF_Lam 542 581 1.04e-3 SMART
EGF 580 612 1.91e-2 SMART
EGF 623 657 2.16e1 SMART
EGF 668 700 2.48e-1 SMART
EGF 711 743 2.81e0 SMART
EGF_Lam 759 798 4.16e-3 SMART
EGF 797 829 1.73e0 SMART
transmembrane domain 856 878 N/A INTRINSIC
low complexity region 1014 1026 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 98% (56/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the multiple epidermal growth factor-like domains protein family. The encoded protein plays a role in cell adhesion, motility and proliferation, and is a critical mediator of apoptotic cell phagocytosis as well as amyloid-beta peptide uptake in the brain. Expression of this gene may be associated with schizophrenia, and mutations in this gene are a cause of early-onset myopathy, areflexia, respiratory distress, and dysphagia (EMARDD) as well as congenital myopathy with minicores. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Apr 2012]
PHENOTYPE: Mice homozygous for a targeted allele exhibit abnormal spacing of starburst amacrine cells and horizontal cells. Homozygotes for another targeted allele exhibit impaired phagocytosis of apoptotic cells by astrocytes. Mice heterozygous for this same allele exhibit mild disorganization of starburts amacrine cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310061I04Rik C G 17: 36,203,963 (GRCm39) S185T probably benign Het
Agfg1 T G 1: 82,872,216 (GRCm39) F516L possibly damaging Het
Akap5 T A 12: 76,374,592 (GRCm39) M8K possibly damaging Het
Aldh1l2 C T 10: 83,342,545 (GRCm39) V535I probably benign Het
Atg3 T C 16: 45,006,564 (GRCm39) V277A probably damaging Het
Bloc1s6 C T 2: 122,588,534 (GRCm39) P168L probably damaging Het
Ccr7 A G 11: 99,036,086 (GRCm39) Y279H probably damaging Het
Cfap210 G T 2: 69,612,103 (GRCm39) S175* probably null Het
Clint1 A G 11: 45,781,562 (GRCm39) T211A probably damaging Het
Dchs2 T G 3: 83,176,662 (GRCm39) D873E probably benign Het
Dhx30 A G 9: 109,926,164 (GRCm39) L149P probably damaging Het
Dnah1 T C 14: 31,033,581 (GRCm39) probably benign Het
Dtx1 A G 5: 120,848,356 (GRCm39) V8A probably benign Het
Enpp3 T A 10: 24,702,078 (GRCm39) K91N possibly damaging Het
Fcho1 C T 8: 72,164,712 (GRCm39) G523E possibly damaging Het
Ffar2 T C 7: 30,518,616 (GRCm39) E308G probably damaging Het
Foxb2 T C 19: 16,850,758 (GRCm39) K83E unknown Het
Git2 A G 5: 114,887,621 (GRCm39) probably null Het
Gm10024 T C 10: 77,547,339 (GRCm39) S17P unknown Het
Greb1l A T 18: 10,542,422 (GRCm39) Y1339F probably benign Het
Grhl2 T A 15: 37,270,912 (GRCm39) D33E probably damaging Het
Herc4 C A 10: 63,126,300 (GRCm39) L551I probably benign Het
Igfn1 T A 1: 135,902,528 (GRCm39) T390S probably benign Het
Ighv3-1 T A 12: 113,928,089 (GRCm39) H90L probably benign Het
Jag2 G T 12: 112,877,279 (GRCm39) Y697* probably null Het
Kif1c T C 11: 70,595,798 (GRCm39) V168A probably damaging Het
Lipn T C 19: 34,046,041 (GRCm39) W5R probably damaging Het
Mavs G A 2: 131,087,245 (GRCm39) A248T probably benign Het
Mib1 A G 18: 10,793,023 (GRCm39) H653R probably benign Het
Mrps9 T G 1: 42,942,537 (GRCm39) S332A probably benign Het
Muc5b T C 7: 141,423,070 (GRCm39) C4498R possibly damaging Het
Myo15b T A 11: 115,778,743 (GRCm39) I1157N possibly damaging Het
Myo9b C T 8: 71,800,451 (GRCm39) T1002M probably benign Het
Nav3 T A 10: 109,520,100 (GRCm39) M2328L probably benign Het
Or5h18 T C 16: 58,847,653 (GRCm39) I206V probably benign Het
Or8b52 T A 9: 38,577,106 (GRCm39) E11D probably benign Het
Pawr T C 10: 108,169,140 (GRCm39) S155P probably damaging Het
Pcdhb15 G T 18: 37,608,090 (GRCm39) V441F probably damaging Het
Plekhg3 A G 12: 76,624,905 (GRCm39) D1250G probably benign Het
Ptprs T A 17: 56,742,853 (GRCm39) M430L possibly damaging Het
Raly T A 2: 154,703,785 (GRCm39) S119T probably damaging Het
Serpinb6a A T 13: 34,109,412 (GRCm39) S128T probably benign Het
Sirt3 C T 7: 140,449,362 (GRCm39) probably benign Het
Slc22a7 A G 17: 46,748,029 (GRCm39) F210L probably damaging Het
Speg G T 1: 75,364,444 (GRCm39) S275I probably damaging Het
Stk32c C T 7: 138,768,141 (GRCm39) D47N unknown Het
Stra6 T G 9: 58,059,822 (GRCm39) S594R probably benign Het
Sun2 T C 15: 79,614,517 (GRCm39) H295R probably benign Het
Syne1 T C 10: 5,053,667 (GRCm39) Q7470R probably damaging Het
Syt14 A T 1: 192,666,126 (GRCm39) H259Q unknown Het
Toporsl A T 4: 52,609,943 (GRCm39) probably benign Het
Trim50 A G 5: 135,382,537 (GRCm39) S130G possibly damaging Het
Tyw1 G A 5: 130,298,065 (GRCm39) R202Q probably damaging Het
Wdr18 T C 10: 79,801,154 (GRCm39) V189A probably benign Het
Zfat C A 15: 68,058,918 (GRCm39) A206S probably damaging Het
Other mutations in Megf10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00425:Megf10 APN 18 57,373,700 (GRCm39) missense probably damaging 1.00
IGL00736:Megf10 APN 18 57,425,782 (GRCm39) missense probably benign 0.35
IGL01631:Megf10 APN 18 57,392,869 (GRCm39) missense possibly damaging 0.61
IGL02488:Megf10 APN 18 57,425,704 (GRCm39) missense probably damaging 1.00
IGL02747:Megf10 APN 18 57,423,565 (GRCm39) missense probably benign 0.43
IGL03298:Megf10 APN 18 57,416,910 (GRCm39) nonsense probably null
deep UTSW 18 57,395,203 (GRCm39) missense probably damaging 1.00
megalodon UTSW 18 57,421,048 (GRCm39) nonsense probably null
sharkie UTSW 18 57,324,257 (GRCm39) nonsense probably null
IGL03046:Megf10 UTSW 18 57,421,055 (GRCm39) missense possibly damaging 0.95
PIT4696001:Megf10 UTSW 18 57,410,760 (GRCm39) missense probably damaging 1.00
R0020:Megf10 UTSW 18 57,420,965 (GRCm39) missense possibly damaging 0.81
R0020:Megf10 UTSW 18 57,420,965 (GRCm39) missense possibly damaging 0.81
R0115:Megf10 UTSW 18 57,392,874 (GRCm39) missense possibly damaging 0.67
R0455:Megf10 UTSW 18 57,386,054 (GRCm39) missense probably benign 0.34
R0602:Megf10 UTSW 18 57,395,172 (GRCm39) missense probably damaging 0.98
R0630:Megf10 UTSW 18 57,421,067 (GRCm39) missense probably benign 0.14
R0652:Megf10 UTSW 18 57,410,796 (GRCm39) missense probably benign 0.00
R0658:Megf10 UTSW 18 57,385,968 (GRCm39) missense probably benign 0.00
R0761:Megf10 UTSW 18 57,421,048 (GRCm39) nonsense probably null
R1013:Megf10 UTSW 18 57,394,291 (GRCm39) missense probably benign 0.00
R1130:Megf10 UTSW 18 57,395,078 (GRCm39) missense probably benign 0.06
R1451:Megf10 UTSW 18 57,385,931 (GRCm39) missense probably damaging 0.97
R1699:Megf10 UTSW 18 57,410,802 (GRCm39) splice site probably null
R1729:Megf10 UTSW 18 57,373,864 (GRCm39) critical splice donor site probably null
R1784:Megf10 UTSW 18 57,373,864 (GRCm39) critical splice donor site probably null
R1870:Megf10 UTSW 18 57,324,257 (GRCm39) nonsense probably null
R1961:Megf10 UTSW 18 57,345,426 (GRCm39) missense probably damaging 0.97
R2094:Megf10 UTSW 18 57,414,785 (GRCm39) nonsense probably null
R2213:Megf10 UTSW 18 57,421,081 (GRCm39) nonsense probably null
R2853:Megf10 UTSW 18 57,427,003 (GRCm39) missense probably damaging 1.00
R3772:Megf10 UTSW 18 57,416,934 (GRCm39) missense probably benign 0.39
R3774:Megf10 UTSW 18 57,410,177 (GRCm39) missense probably damaging 1.00
R3775:Megf10 UTSW 18 57,410,177 (GRCm39) missense probably damaging 1.00
R3776:Megf10 UTSW 18 57,410,177 (GRCm39) missense probably damaging 1.00
R3858:Megf10 UTSW 18 57,408,907 (GRCm39) splice site probably benign
R3911:Megf10 UTSW 18 57,422,465 (GRCm39) missense probably damaging 0.99
R3966:Megf10 UTSW 18 57,313,646 (GRCm39) missense probably damaging 1.00
R4043:Megf10 UTSW 18 57,392,870 (GRCm39) missense probably damaging 0.98
R4131:Megf10 UTSW 18 57,313,607 (GRCm39) missense probably damaging 1.00
R4598:Megf10 UTSW 18 57,420,884 (GRCm39) missense probably damaging 1.00
R4598:Megf10 UTSW 18 57,322,675 (GRCm39) critical splice donor site probably null
R4726:Megf10 UTSW 18 57,420,864 (GRCm39) missense probably benign 0.32
R4765:Megf10 UTSW 18 57,420,866 (GRCm39) missense possibly damaging 0.56
R4874:Megf10 UTSW 18 57,426,930 (GRCm39) missense probably benign 0.00
R4928:Megf10 UTSW 18 57,373,745 (GRCm39) missense probably benign
R5412:Megf10 UTSW 18 57,324,219 (GRCm39) missense probably damaging 0.99
R5901:Megf10 UTSW 18 57,410,180 (GRCm39) missense probably benign 0.11
R6015:Megf10 UTSW 18 57,386,100 (GRCm39) missense probably benign 0.01
R6036:Megf10 UTSW 18 57,375,799 (GRCm39) missense probably damaging 1.00
R6036:Megf10 UTSW 18 57,375,799 (GRCm39) missense probably damaging 1.00
R6041:Megf10 UTSW 18 57,313,621 (GRCm39) missense probably benign
R6369:Megf10 UTSW 18 57,394,259 (GRCm39) missense probably benign 0.06
R6479:Megf10 UTSW 18 57,379,642 (GRCm39) missense possibly damaging 0.76
R6489:Megf10 UTSW 18 57,424,879 (GRCm39) missense probably benign 0.01
R7228:Megf10 UTSW 18 57,322,661 (GRCm39) missense probably damaging 1.00
R7296:Megf10 UTSW 18 57,408,825 (GRCm39) missense probably damaging 1.00
R7437:Megf10 UTSW 18 57,395,203 (GRCm39) missense probably damaging 1.00
R7461:Megf10 UTSW 18 57,385,925 (GRCm39) missense probably damaging 0.98
R7488:Megf10 UTSW 18 57,324,187 (GRCm39) missense probably damaging 0.99
R7492:Megf10 UTSW 18 57,424,866 (GRCm39) missense probably benign 0.00
R7542:Megf10 UTSW 18 57,322,642 (GRCm39) missense probably benign 0.07
R7636:Megf10 UTSW 18 57,410,061 (GRCm39) missense possibly damaging 0.85
R7646:Megf10 UTSW 18 57,427,071 (GRCm39) unclassified probably benign
R7650:Megf10 UTSW 18 57,427,071 (GRCm39) unclassified probably benign
R7713:Megf10 UTSW 18 57,427,071 (GRCm39) unclassified probably benign
R7714:Megf10 UTSW 18 57,427,071 (GRCm39) unclassified probably benign
R7716:Megf10 UTSW 18 57,427,071 (GRCm39) unclassified probably benign
R7796:Megf10 UTSW 18 57,410,731 (GRCm39) missense possibly damaging 0.85
R7915:Megf10 UTSW 18 57,373,807 (GRCm39) missense probably benign 0.05
R8221:Megf10 UTSW 18 57,416,893 (GRCm39) missense probably benign 0.00
R8527:Megf10 UTSW 18 57,425,790 (GRCm39) missense probably benign 0.00
R8559:Megf10 UTSW 18 57,373,699 (GRCm39) missense probably damaging 1.00
R9337:Megf10 UTSW 18 57,394,252 (GRCm39) nonsense probably null
R9481:Megf10 UTSW 18 57,395,090 (GRCm39) missense probably benign 0.38
R9644:Megf10 UTSW 18 57,375,773 (GRCm39) missense probably benign
RF003:Megf10 UTSW 18 57,427,099 (GRCm39) unclassified probably benign
Z1176:Megf10 UTSW 18 57,410,766 (GRCm39) missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- CCACCCACAGGAATTAGGTC -3'
(R):5'- TTCCCATGAATGCTGAGAATGG -3'

Sequencing Primer
(F):5'- GTCTAAACCGTGTTTGTGGAATTACC -3'
(R):5'- CGTAAAACGTGCTGTTGCTATTC -3'
Posted On 2021-12-30