Incidental Mutation 'R9117:Megf10'
ID 692628
Institutional Source Beutler Lab
Gene Symbol Megf10
Ensembl Gene ENSMUSG00000024593
Gene Name multiple EGF-like-domains 10
Synonyms 3000002B06Rik, LOC240312
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.160) question?
Stock # R9117 (G1)
Quality Score 225.009
Status Validated
Chromosome 18
Chromosomal Location 57133090-57297467 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 57259701 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glycine to Aspartic acid at position 390 (G390D)
Ref Sequence ENSEMBL: ENSMUSP00000075174 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075770] [ENSMUST00000139892]
AlphaFold Q6DIB5
Predicted Effect probably damaging
Transcript: ENSMUST00000075770
AA Change: G390D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000075174
Gene: ENSMUSG00000024593
AA Change: G390D

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
EGF 108 136 9.41e-2 SMART
EGF_Lam 152 191 3.57e-2 SMART
EGF 190 222 5.79e-2 SMART
EGF 233 265 1.78e-2 SMART
EGF_Lam 281 320 7.58e-6 SMART
EGF 319 351 7.13e-2 SMART
EGF_Lam 368 409 9.05e-4 SMART
EGF 408 440 8.78e-2 SMART
EGF 451 483 2.85e-1 SMART
EGF 494 526 2.02e-1 SMART
EGF_Lam 542 581 1.04e-3 SMART
EGF 580 612 1.91e-2 SMART
EGF 623 657 2.16e1 SMART
EGF 668 700 2.48e-1 SMART
EGF 711 743 2.81e0 SMART
EGF_Lam 759 798 4.16e-3 SMART
EGF 797 829 1.73e0 SMART
transmembrane domain 856 878 N/A INTRINSIC
low complexity region 1014 1026 N/A INTRINSIC
low complexity region 1131 1146 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000139892
AA Change: G390D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000116814
Gene: ENSMUSG00000024593
AA Change: G390D

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
EGF 108 136 9.41e-2 SMART
EGF_Lam 152 191 3.57e-2 SMART
EGF 190 222 5.79e-2 SMART
EGF 233 265 1.78e-2 SMART
EGF_Lam 281 320 7.58e-6 SMART
EGF 319 351 7.13e-2 SMART
EGF_Lam 368 409 9.05e-4 SMART
EGF 408 440 8.78e-2 SMART
EGF 451 483 2.85e-1 SMART
EGF 494 526 2.02e-1 SMART
EGF_Lam 542 581 1.04e-3 SMART
EGF 580 612 1.91e-2 SMART
EGF 623 657 2.16e1 SMART
EGF 668 700 2.48e-1 SMART
EGF 711 743 2.81e0 SMART
EGF_Lam 759 798 4.16e-3 SMART
EGF 797 829 1.73e0 SMART
transmembrane domain 856 878 N/A INTRINSIC
low complexity region 1014 1026 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 98% (56/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the multiple epidermal growth factor-like domains protein family. The encoded protein plays a role in cell adhesion, motility and proliferation, and is a critical mediator of apoptotic cell phagocytosis as well as amyloid-beta peptide uptake in the brain. Expression of this gene may be associated with schizophrenia, and mutations in this gene are a cause of early-onset myopathy, areflexia, respiratory distress, and dysphagia (EMARDD) as well as congenital myopathy with minicores. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Apr 2012]
PHENOTYPE: Mice homozygous for a targeted allele exhibit abnormal spacing of starburst amacrine cells and horizontal cells. Homozygotes for another targeted allele exhibit impaired phagocytosis of apoptotic cells by astrocytes. Mice heterozygous for this same allele exhibit mild disorganization of starburts amacrine cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310061I04Rik C G 17: 35,893,071 S185T probably benign Het
Agfg1 T G 1: 82,894,495 F516L possibly damaging Het
Akap5 T A 12: 76,327,818 M8K possibly damaging Het
Aldh1l2 C T 10: 83,506,681 V535I probably benign Het
Atg3 T C 16: 45,186,201 V277A probably damaging Het
Bloc1s6 C T 2: 122,746,614 P168L probably damaging Het
Ccdc173 G T 2: 69,781,759 S175* probably null Het
Ccr7 A G 11: 99,145,260 Y279H probably damaging Het
Clint1 A G 11: 45,890,735 T211A probably damaging Het
Dchs2 T G 3: 83,269,355 D873E probably benign Het
Dhx30 A G 9: 110,097,096 L149P probably damaging Het
Dnah1 T C 14: 31,311,624 probably benign Het
Dtx1 A G 5: 120,710,291 V8A probably benign Het
Enpp3 T A 10: 24,826,180 K91N possibly damaging Het
Fcho1 C T 8: 71,712,068 G523E possibly damaging Het
Ffar2 T C 7: 30,819,191 E308G probably damaging Het
Foxb2 T C 19: 16,873,394 K83E unknown Het
Git2 A G 5: 114,749,560 probably null Het
Gm10024 T C 10: 77,711,505 S17P unknown Het
Greb1l A T 18: 10,542,422 Y1339F probably benign Het
Grhl2 T A 15: 37,270,668 D33E probably damaging Het
Herc4 C A 10: 63,290,521 L551I probably benign Het
Igfn1 T A 1: 135,974,790 T390S probably benign Het
Ighv3-1 T A 12: 113,964,469 H90L probably benign Het
Jag2 G T 12: 112,913,659 Y697* probably null Het
Kif1c T C 11: 70,704,972 V168A probably damaging Het
Lipn T C 19: 34,068,641 W5R probably damaging Het
Mavs G A 2: 131,245,325 A248T probably benign Het
Mib1 A G 18: 10,793,023 H653R probably benign Het
Mrps9 T G 1: 42,903,377 S332A probably benign Het
Muc5b T C 7: 141,869,333 C4498R possibly damaging Het
Myo15b T A 11: 115,887,917 I1157N possibly damaging Het
Myo9b C T 8: 71,347,807 T1002M probably benign Het
Nav3 T A 10: 109,684,239 M2328L probably benign Het
Olfr186 T C 16: 59,027,290 I206V probably benign Het
Olfr917 T A 9: 38,665,810 E11D probably benign Het
Pawr T C 10: 108,333,279 S155P probably damaging Het
Pcdhb15 G T 18: 37,475,037 V441F probably damaging Het
Plekhg3 A G 12: 76,578,131 D1250G probably benign Het
Ptprs T A 17: 56,435,853 M430L possibly damaging Het
Raly T A 2: 154,861,865 S119T probably damaging Het
Serpinb6a A T 13: 33,925,429 S128T probably benign Het
Sirt3 C T 7: 140,869,449 probably benign Het
Slc22a7 A G 17: 46,437,103 F210L probably damaging Het
Speg G T 1: 75,387,800 S275I probably damaging Het
Stk32c C T 7: 139,188,225 D47N unknown Het
Stra6 T G 9: 58,152,539 S594R probably benign Het
Sun2 T C 15: 79,730,316 H295R probably benign Het
Syne1 T C 10: 5,103,667 Q7470R probably damaging Het
Syt14 A T 1: 192,983,818 H259Q unknown Het
Toporsl A T 4: 52,609,943 probably benign Het
Trim50 A G 5: 135,353,683 S130G possibly damaging Het
Tyw1 G A 5: 130,269,224 R202Q probably damaging Het
Wdr18 T C 10: 79,965,320 V189A probably benign Het
Zfat C A 15: 68,187,069 A206S probably damaging Het
Other mutations in Megf10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00425:Megf10 APN 18 57240628 missense probably damaging 1.00
IGL00736:Megf10 APN 18 57292710 missense probably benign 0.35
IGL01631:Megf10 APN 18 57259797 missense possibly damaging 0.61
IGL02488:Megf10 APN 18 57292632 missense probably damaging 1.00
IGL02747:Megf10 APN 18 57290493 missense probably benign 0.43
IGL03298:Megf10 APN 18 57283838 nonsense probably null
deep UTSW 18 57262131 missense probably damaging 1.00
megalodon UTSW 18 57287976 nonsense probably null
sharkie UTSW 18 57191185 nonsense probably null
IGL03046:Megf10 UTSW 18 57287983 missense possibly damaging 0.95
PIT4696001:Megf10 UTSW 18 57277688 missense probably damaging 1.00
R0020:Megf10 UTSW 18 57287893 missense possibly damaging 0.81
R0020:Megf10 UTSW 18 57287893 missense possibly damaging 0.81
R0115:Megf10 UTSW 18 57259802 missense possibly damaging 0.67
R0455:Megf10 UTSW 18 57252982 missense probably benign 0.34
R0602:Megf10 UTSW 18 57262100 missense probably damaging 0.98
R0630:Megf10 UTSW 18 57287995 missense probably benign 0.14
R0652:Megf10 UTSW 18 57277724 missense probably benign 0.00
R0658:Megf10 UTSW 18 57252896 missense probably benign 0.00
R0761:Megf10 UTSW 18 57287976 nonsense probably null
R1013:Megf10 UTSW 18 57261219 missense probably benign 0.00
R1130:Megf10 UTSW 18 57262006 missense probably benign 0.06
R1451:Megf10 UTSW 18 57252859 missense probably damaging 0.97
R1699:Megf10 UTSW 18 57277730 splice site probably null
R1729:Megf10 UTSW 18 57240792 critical splice donor site probably null
R1784:Megf10 UTSW 18 57240792 critical splice donor site probably null
R1870:Megf10 UTSW 18 57191185 nonsense probably null
R1961:Megf10 UTSW 18 57212354 missense probably damaging 0.97
R2094:Megf10 UTSW 18 57281713 nonsense probably null
R2213:Megf10 UTSW 18 57288009 nonsense probably null
R2853:Megf10 UTSW 18 57293931 missense probably damaging 1.00
R3772:Megf10 UTSW 18 57283862 missense probably benign 0.39
R3774:Megf10 UTSW 18 57277105 missense probably damaging 1.00
R3775:Megf10 UTSW 18 57277105 missense probably damaging 1.00
R3776:Megf10 UTSW 18 57277105 missense probably damaging 1.00
R3858:Megf10 UTSW 18 57275835 splice site probably benign
R3911:Megf10 UTSW 18 57289393 missense probably damaging 0.99
R3966:Megf10 UTSW 18 57180574 missense probably damaging 1.00
R4043:Megf10 UTSW 18 57259798 missense probably damaging 0.98
R4131:Megf10 UTSW 18 57180535 missense probably damaging 1.00
R4598:Megf10 UTSW 18 57189603 critical splice donor site probably null
R4598:Megf10 UTSW 18 57287812 missense probably damaging 1.00
R4726:Megf10 UTSW 18 57287792 missense probably benign 0.32
R4765:Megf10 UTSW 18 57287794 missense possibly damaging 0.56
R4874:Megf10 UTSW 18 57293858 missense probably benign 0.00
R4928:Megf10 UTSW 18 57240673 missense probably benign
R5412:Megf10 UTSW 18 57191147 missense probably damaging 0.99
R5901:Megf10 UTSW 18 57277108 missense probably benign 0.11
R6015:Megf10 UTSW 18 57253028 missense probably benign 0.01
R6036:Megf10 UTSW 18 57242727 missense probably damaging 1.00
R6036:Megf10 UTSW 18 57242727 missense probably damaging 1.00
R6041:Megf10 UTSW 18 57180549 missense probably benign
R6369:Megf10 UTSW 18 57261187 missense probably benign 0.06
R6479:Megf10 UTSW 18 57246570 missense possibly damaging 0.76
R6489:Megf10 UTSW 18 57291807 missense probably benign 0.01
R7228:Megf10 UTSW 18 57189589 missense probably damaging 1.00
R7296:Megf10 UTSW 18 57275753 missense probably damaging 1.00
R7437:Megf10 UTSW 18 57262131 missense probably damaging 1.00
R7461:Megf10 UTSW 18 57252853 missense probably damaging 0.98
R7488:Megf10 UTSW 18 57191115 missense probably damaging 0.99
R7492:Megf10 UTSW 18 57291794 missense probably benign 0.00
R7542:Megf10 UTSW 18 57189570 missense probably benign 0.07
R7636:Megf10 UTSW 18 57276989 missense possibly damaging 0.85
R7646:Megf10 UTSW 18 57293999 unclassified probably benign
R7650:Megf10 UTSW 18 57293999 unclassified probably benign
R7713:Megf10 UTSW 18 57293999 unclassified probably benign
R7714:Megf10 UTSW 18 57293999 unclassified probably benign
R7716:Megf10 UTSW 18 57293999 unclassified probably benign
R7796:Megf10 UTSW 18 57277659 missense possibly damaging 0.85
R7915:Megf10 UTSW 18 57240735 missense probably benign 0.05
R8221:Megf10 UTSW 18 57283821 missense probably benign 0.00
R8527:Megf10 UTSW 18 57292718 missense probably benign 0.00
R8559:Megf10 UTSW 18 57240627 missense probably damaging 1.00
R9337:Megf10 UTSW 18 57261180 nonsense probably null
R9481:Megf10 UTSW 18 57262018 missense probably benign 0.38
R9644:Megf10 UTSW 18 57242701 missense probably benign
RF003:Megf10 UTSW 18 57294027 unclassified probably benign
Z1176:Megf10 UTSW 18 57277694 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- CCACCCACAGGAATTAGGTC -3'
(R):5'- TTCCCATGAATGCTGAGAATGG -3'

Sequencing Primer
(F):5'- GTCTAAACCGTGTTTGTGGAATTACC -3'
(R):5'- CGTAAAACGTGCTGTTGCTATTC -3'
Posted On 2021-12-30