Mutagenetix > Incidental Mutation

Incidental Mutation 'R9118:Casc1'

692639

Institutional Source

Beutler Lab

Gene Symbol

Casc1

Ensembl Gene

ENSMUSG00000043541

Gene Name

cancer susceptibility candidate 1

Synonyms

A230084G12Rik, Las1

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.062) question?

Stock #

R9118 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

145174834-145211005 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 145175245 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 667 (L667P)

Ref Sequence

ENSEMBL: ENSMUSP00000062279 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000032396] [ENSMUST00000060797] [ENSMUST00000111728] [ENSMUST00000135984] [ENSMUST00000204105]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000032396

SMART Domains

Protein: ENSMUSP00000032396
Gene: ENSMUSG00000030263

Domain	Start	End	E-Value	Type
Pfam:MRVI1	10	539	3.2e-265	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000060797
AA Change: L667P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000062279
Gene: ENSMUSG00000043541
AA Change: L667P

Domain	Start	End	E-Value	Type
low complexity region	1	14	N/A	INTRINSIC
Pfam:Casc1_N	29	229	5.5e-61	PFAM
Pfam:Casc1	241	469	3.4e-15	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000111728
AA Change: L616P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000107357
Gene: ENSMUSG00000043541
AA Change: L616P

Domain	Start	End	E-Value	Type
coiled coil region	1	45	N/A	INTRINSIC
Pfam:Casc1	228	456	6.1e-15	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000132948

SMART Domains

Protein: ENSMUSP00000120248
Gene: ENSMUSG00000030263

Domain	Start	End	E-Value	Type
Pfam:MRVI1	8	504	3.7e-248	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000135984

Predicted Effect

probably benign
Transcript: ENSMUST00000204105

SMART Domains

Protein: ENSMUSP00000144783
Gene: ENSMUSG00000043541

Domain	Start	End	E-Value	Type
low complexity region	1	14	N/A	INTRINSIC
Pfam:Casc1_N	29	229	3.4e-57	PFAM
Pfam:Casc1	241	469	2.3e-11	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

97% (31/32)

MGI Phenotype

PHENOTYPE: Mice with disruptions of this gene display a higher incidence of lung tumors. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 32 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acaa1b	A	T	9: 119,156,889	S36T	probably benign	Het
Aifm2	C	T	10: 61,725,902	T9I	probably benign	Het
Ano5	T	A	7: 51,570,374	F421I	probably damaging	Het
Cacna1a	G	A	8: 84,536,086	V372M	probably damaging	Het
Cbwd1	T	C	19: 24,942,684	R190G	probably damaging	Het
Col6a5	A	T	9: 105,878,654		probably benign	Het
Colgalt2	A	G	1: 152,503,155		probably benign	Het
Crybg1	T	C	10: 44,003,929	D421G	possibly damaging	Het
Dgat1	A	T	15: 76,502,518	W440R	probably damaging	Het
Dnah5	TGTCCGACTACAACATCGAGACGGCCAAGCGCGTC	TGTC	15: 28,401,848		probably null	Het
Eif4h	C	A	5: 134,627,627	V70L	probably benign	Het
Gabrd	C	A	4: 155,386,018	V326L	possibly damaging	Het
Krt2	C	T	15: 101,814,541	E341K	probably damaging	Het
Lrp4	C	T	2: 91,478,582	A538V	possibly damaging	Het
Mfap3l	G	A	8: 60,656,682	V31M	probably damaging	Het
Mroh2b	T	C	15: 4,962,091	I1557T	possibly damaging	Het
Olfr1388	A	T	11: 49,444,582	I244F	probably benign	Het
Olfr235	T	C	19: 12,268,899	V223A	probably benign	Het
Pcyt2	G	A	11: 120,613,073	P183L		Het
Rapsn	A	G	2: 91,045,033	H387R	probably damaging	Het
Scaf11	G	A	15: 96,422,005	A259V	probably benign	Het
Sept9	A	G	11: 117,266,572	D11G	probably benign	Het
Sfi1	ACA	ACATCTTCCCAAAGCCAGTCA	11: 3,153,382		probably benign	Het
Slc7a2	T	A	8: 40,898,957	I19N	possibly damaging	Het
Synpr	T	C	14: 13,608,673	V171A	probably damaging	Het
Tmed7	T	C	18: 46,593,271	N139S	probably benign	Het
Tnks1bp1	G	T	2: 85,063,376	G1216W	probably damaging	Het
Ush2a	T	A	1: 188,654,642	V2338E	probably damaging	Het
Vmn1r152	A	T	7: 22,523,567	I201F		Het
Vmn2r106	C	A	17: 20,285,405	W9L	probably benign	Het
Vmn2r9	A	G	5: 108,843,071	V808A	probably damaging	Het
Zfp646	A	G	7: 127,881,638	T996A		Het

Other mutations in Casc1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00160:Casc1	APN	6	145175290	missense	probably benign	0.00
IGL00586:Casc1	APN	6	145191576	missense	possibly damaging	0.53
IGL01066:Casc1	APN	6	145176222	missense	probably damaging	0.96
IGL01413:Casc1	APN	6	145175086	missense	probably damaging	1.00
IGL02275:Casc1	APN	6	145177364	missense	probably damaging	1.00
IGL02668:Casc1	APN	6	145205257	missense	unknown
IGL03018:Casc1	APN	6	145183305	missense	probably damaging	1.00
IGL03233:Casc1	APN	6	145181885	missense	probably damaging	1.00
R0011:Casc1	UTSW	6	145179055	missense	probably damaging	1.00
R0011:Casc1	UTSW	6	145179055	missense	probably damaging	1.00
R0180:Casc1	UTSW	6	145183218	critical splice donor site	probably benign
R0786:Casc1	UTSW	6	145181757	critical splice donor site	probably null
R1916:Casc1	UTSW	6	145176200	missense	probably benign	0.37
R2117:Casc1	UTSW	6	145205241	critical splice donor site	probably null
R2174:Casc1	UTSW	6	145175170	missense	probably damaging	1.00
R2264:Casc1	UTSW	6	145208429	utr 5 prime	probably benign
R4393:Casc1	UTSW	6	145194578	missense	possibly damaging	0.49
R4467:Casc1	UTSW	6	145183218	critical splice donor site	probably null
R4847:Casc1	UTSW	6	145175185	missense	probably damaging	1.00
R5014:Casc1	UTSW	6	145183266	missense	probably damaging	1.00
R5207:Casc1	UTSW	6	145179068	missense	probably damaging	1.00
R5264:Casc1	UTSW	6	145181776	missense	probably benign	0.02
R5359:Casc1	UTSW	6	145196892	missense	probably damaging	1.00
R5499:Casc1	UTSW	6	145177431	missense	probably damaging	1.00
R6211:Casc1	UTSW	6	145200491	missense	probably damaging	1.00
R6579:Casc1	UTSW	6	145179018	missense	probably benign	0.19
R6939:Casc1	UTSW	6	145175219	missense	possibly damaging	0.46
R7108:Casc1	UTSW	6	145185865	nonsense	probably null
R7131:Casc1	UTSW	6	145177406	missense	probably null	0.97
R7810:Casc1	UTSW	6	145194586	missense	probably benign	0.28
R8017:Casc1	UTSW	6	145194557	missense	probably damaging	1.00
R8385:Casc1	UTSW	6	145175192	missense	probably damaging	1.00
R8680:Casc1	UTSW	6	145181816	missense	probably benign	0.13
R8720:Casc1	UTSW	6	145205257	missense	unknown
R9118:Casc1	UTSW	6	145175174	missense	probably damaging	1.00
R9172:Casc1	UTSW	6	145177449	missense	probably benign
R9290:Casc1	UTSW	6	145202962	missense	unknown
X0063:Casc1	UTSW	6	145175271	missense	probably benign	0.13
Z1176:Casc1	UTSW	6	145205293	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- TACACACGCTGTAAGGGCTAG -3'
(R):5'- GAGAGACTTATCTGCAAGCTGGG -3'

Sequencing Primer
(F):5'- CGCTGTAAGGGCTAGGAATAGC -3'
(R):5'- ACTTATCTGCAAGCTGGGTAATTTG -3'

Posted On

2021-12-30