Mutagenetix > Incidental Mutation

Incidental Mutation 'R9118:Krt2'

692658

Institutional Source

Beutler Lab

Gene Symbol

Krt2

Ensembl Gene

ENSMUSG00000064201

Gene Name

keratin 2

Synonyms

Krt2-17, Krt2-2, Krt2e

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.078) question?

Stock #

R9118 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

101810689-101818169 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 101814541 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Lysine at position 341 (E341K)

Ref Sequence

ENSEMBL: ENSMUSP00000023712 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000023712]

AlphaFold

Q3TTY5

Predicted Effect

probably damaging
Transcript: ENSMUST00000023712
AA Change: E341K

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000023712
Gene: ENSMUSG00000064201
AA Change: E341K

Domain	Start	End	E-Value	Type
Pfam:Keratin_2_head	23	195	3.6e-26	PFAM
Filament	198	511	4.22e-152	SMART
low complexity region	520	533	N/A	INTRINSIC
low complexity region	538	701	N/A	INTRINSIC

Meta Mutation Damage Score

0.6121

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

97% (31/32)

MGI Phenotype

PHENOTYPE: ENU-induced mutant mice exhibit scaly skin and increased pigmentation in the tail, ears and feet. Mice homozygous for a knock-out allele show scaly skin, acanthosis, hyperkeratosis, increased water loss, ear skin inflammation, and aberrant aggregation of keratin 10 in suprabasal epidermal keratinocytes. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 33 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acaa1b	A	T	9: 119,156,889	S36T	probably benign	Het
Aifm2	C	T	10: 61,725,902	T9I	probably benign	Het
Ano5	T	A	7: 51,570,374	F421I	probably damaging	Het
Cacna1a	G	A	8: 84,536,086	V372M	probably damaging	Het
Casc1	A	G	6: 145,175,174	Y691H	probably damaging	Het
Casc1	A	G	6: 145,175,245	L667P	probably damaging	Het
Cbwd1	T	C	19: 24,942,684	R190G	probably damaging	Het
Col6a5	A	T	9: 105,878,654		probably benign	Het
Colgalt2	A	G	1: 152,503,155		probably benign	Het
Crybg1	T	C	10: 44,003,929	D421G	possibly damaging	Het
Dgat1	A	T	15: 76,502,518	W440R	probably damaging	Het
Dnah5	TGTCCGACTACAACATCGAGACGGCCAAGCGCGTC	TGTC	15: 28,401,848		probably null	Het
Eif4h	C	A	5: 134,627,627	V70L	probably benign	Het
Gabrd	C	A	4: 155,386,018	V326L	possibly damaging	Het
Lrp4	C	T	2: 91,478,582	A538V	possibly damaging	Het
Mfap3l	G	A	8: 60,656,682	V31M	probably damaging	Het
Mroh2b	T	C	15: 4,962,091	I1557T	possibly damaging	Het
Olfr1388	A	T	11: 49,444,582	I244F	probably benign	Het
Olfr235	T	C	19: 12,268,899	V223A	probably benign	Het
Pcyt2	G	A	11: 120,613,073	P183L		Het
Rapsn	A	G	2: 91,045,033	H387R	probably damaging	Het
Scaf11	G	A	15: 96,422,005	A259V	probably benign	Het
Sept9	A	G	11: 117,266,572	D11G	probably benign	Het
Sfi1	ACA	ACATCTTCCCAAAGCCAGTCA	11: 3,153,382		probably benign	Het
Slc7a2	T	A	8: 40,898,957	I19N	possibly damaging	Het
Synpr	T	C	14: 13,608,673	V171A	probably damaging	Het
Tmed7	T	C	18: 46,593,271	N139S	probably benign	Het
Tnks1bp1	G	T	2: 85,063,376	G1216W	probably damaging	Het
Ush2a	T	A	1: 188,654,642	V2338E	probably damaging	Het
Vmn1r152	A	T	7: 22,523,567	I201F		Het
Vmn2r106	C	A	17: 20,285,405	W9L	probably benign	Het
Vmn2r9	A	G	5: 108,843,071	V808A	probably damaging	Het
Zfp646	A	G	7: 127,881,638	T996A		Het

Other mutations in Krt2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01316:Krt2	APN	15	101811211	missense	probably benign	0.23
IGL01568:Krt2	APN	15	101813211	missense	probably damaging	1.00
IGL01586:Krt2	APN	15	101811390	missense	unknown
IGL01667:Krt2	APN	15	101816330	missense	possibly damaging	0.85
IGL02017:Krt2	APN	15	101816504	missense	probably damaging	1.00
IGL02022:Krt2	APN	15	101816518	missense	probably damaging	1.00
IGL02538:Krt2	APN	15	101811154	missense	unknown
IGL02959:Krt2	APN	15	101811328	missense	unknown
IGL03295:Krt2	APN	15	101816429	missense	probably damaging	0.99
R0195:Krt2	UTSW	15	101813191	nonsense	probably null
R0472:Krt2	UTSW	15	101813253	missense	probably damaging	1.00
R0749:Krt2	UTSW	15	101817663	missense	unknown
R0785:Krt2	UTSW	15	101817921	missense	unknown
R0792:Krt2	UTSW	15	101816497	missense	probably damaging	1.00
R1232:Krt2	UTSW	15	101811784	missense	probably damaging	1.00
R1281:Krt2	UTSW	15	101813292	missense	probably damaging	1.00
R1770:Krt2	UTSW	15	101811154	missense	unknown
R1783:Krt2	UTSW	15	101813973	missense	probably damaging	1.00
R1795:Krt2	UTSW	15	101816426	missense	possibly damaging	0.85
R2283:Krt2	UTSW	15	101814387	missense	probably damaging	1.00
R3977:Krt2	UTSW	15	101811127	missense	unknown
R4575:Krt2	UTSW	15	101814486	missense	probably damaging	1.00
R4619:Krt2	UTSW	15	101817591	missense	probably damaging	1.00
R4620:Krt2	UTSW	15	101817591	missense	probably damaging	1.00
R4766:Krt2	UTSW	15	101813960	missense	probably damaging	1.00
R4819:Krt2	UTSW	15	101811544	missense	unknown
R4953:Krt2	UTSW	15	101813942	missense	probably damaging	1.00
R5108:Krt2	UTSW	15	101813286	missense	possibly damaging	0.88
R5973:Krt2	UTSW	15	101816312	missense	probably damaging	0.99
R6122:Krt2	UTSW	15	101815914	missense	probably damaging	1.00
R6180:Krt2	UTSW	15	101815044	missense	probably benign	0.05
R6661:Krt2	UTSW	15	101815963	missense	probably damaging	1.00
R6974:Krt2	UTSW	15	101817879	missense	unknown
R6993:Krt2	UTSW	15	101815960	missense	probably damaging	1.00
R7104:Krt2	UTSW	15	101815087	missense	probably benign	0.09
R7573:Krt2	UTSW	15	101814519	missense	probably benign	0.05
R7947:Krt2	UTSW	15	101816334	missense	probably damaging	1.00
R8469:Krt2	UTSW	15	101816369	missense	probably benign	0.22
R8805:Krt2	UTSW	15	101815944	missense	possibly damaging	0.93
R9051:Krt2	UTSW	15	101817882	missense	unknown
R9230:Krt2	UTSW	15	101817513	missense	probably benign	0.39
R9257:Krt2	UTSW	15	101816491	missense	probably benign	0.05
R9424:Krt2	UTSW	15	101811357	missense	unknown
R9569:Krt2	UTSW	15	101816489	missense	probably damaging	1.00
R9576:Krt2	UTSW	15	101811357	missense	unknown
RF020:Krt2	UTSW	15	101817968	missense	unknown
Z1177:Krt2	UTSW	15	101811550	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- TAGTGAAGCTCAGCTGTGTC -3'
(R):5'- ATGTGTGATGTCTCCTGCTC -3'

Sequencing Primer
(F):5'- AGCTGTGTCCCCCTATGG -3'
(R):5'- GTGATGTCTCCTGCTCCCCTTC -3'

Posted On

2021-12-30