Incidental Mutation 'R9118:Krt2'
ID 692658
Institutional Source Beutler Lab
Gene Symbol Krt2
Ensembl Gene ENSMUSG00000064201
Gene Name keratin 2
Synonyms Krt2-17, Krt2-2, Krt2e
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock # R9118 (G1)
Quality Score 225.009
Status Validated
Chromosome 15
Chromosomal Location 101810689-101818169 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 101814541 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Lysine at position 341 (E341K)
Ref Sequence ENSEMBL: ENSMUSP00000023712 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023712]
AlphaFold Q3TTY5
Predicted Effect probably damaging
Transcript: ENSMUST00000023712
AA Change: E341K

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000023712
Gene: ENSMUSG00000064201
AA Change: E341K

DomainStartEndE-ValueType
Pfam:Keratin_2_head 23 195 3.6e-26 PFAM
Filament 198 511 4.22e-152 SMART
low complexity region 520 533 N/A INTRINSIC
low complexity region 538 701 N/A INTRINSIC
Meta Mutation Damage Score 0.6121 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 97% (31/32)
MGI Phenotype PHENOTYPE: ENU-induced mutant mice exhibit scaly skin and increased pigmentation in the tail, ears and feet. Mice homozygous for a knock-out allele show scaly skin, acanthosis, hyperkeratosis, increased water loss, ear skin inflammation, and aberrant aggregation of keratin 10 in suprabasal epidermal keratinocytes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaa1b A T 9: 119,156,889 S36T probably benign Het
Aifm2 C T 10: 61,725,902 T9I probably benign Het
Ano5 T A 7: 51,570,374 F421I probably damaging Het
Cacna1a G A 8: 84,536,086 V372M probably damaging Het
Casc1 A G 6: 145,175,174 Y691H probably damaging Het
Casc1 A G 6: 145,175,245 L667P probably damaging Het
Cbwd1 T C 19: 24,942,684 R190G probably damaging Het
Col6a5 A T 9: 105,878,654 probably benign Het
Colgalt2 A G 1: 152,503,155 probably benign Het
Crybg1 T C 10: 44,003,929 D421G possibly damaging Het
Dgat1 A T 15: 76,502,518 W440R probably damaging Het
Dnah5 TGTCCGACTACAACATCGAGACGGCCAAGCGCGTC TGTC 15: 28,401,848 probably null Het
Eif4h C A 5: 134,627,627 V70L probably benign Het
Gabrd C A 4: 155,386,018 V326L possibly damaging Het
Lrp4 C T 2: 91,478,582 A538V possibly damaging Het
Mfap3l G A 8: 60,656,682 V31M probably damaging Het
Mroh2b T C 15: 4,962,091 I1557T possibly damaging Het
Olfr1388 A T 11: 49,444,582 I244F probably benign Het
Olfr235 T C 19: 12,268,899 V223A probably benign Het
Pcyt2 G A 11: 120,613,073 P183L Het
Rapsn A G 2: 91,045,033 H387R probably damaging Het
Scaf11 G A 15: 96,422,005 A259V probably benign Het
Sept9 A G 11: 117,266,572 D11G probably benign Het
Sfi1 ACA ACATCTTCCCAAAGCCAGTCA 11: 3,153,382 probably benign Het
Slc7a2 T A 8: 40,898,957 I19N possibly damaging Het
Synpr T C 14: 13,608,673 V171A probably damaging Het
Tmed7 T C 18: 46,593,271 N139S probably benign Het
Tnks1bp1 G T 2: 85,063,376 G1216W probably damaging Het
Ush2a T A 1: 188,654,642 V2338E probably damaging Het
Vmn1r152 A T 7: 22,523,567 I201F Het
Vmn2r106 C A 17: 20,285,405 W9L probably benign Het
Vmn2r9 A G 5: 108,843,071 V808A probably damaging Het
Zfp646 A G 7: 127,881,638 T996A Het
Other mutations in Krt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01316:Krt2 APN 15 101811211 missense probably benign 0.23
IGL01568:Krt2 APN 15 101813211 missense probably damaging 1.00
IGL01586:Krt2 APN 15 101811390 missense unknown
IGL01667:Krt2 APN 15 101816330 missense possibly damaging 0.85
IGL02017:Krt2 APN 15 101816504 missense probably damaging 1.00
IGL02022:Krt2 APN 15 101816518 missense probably damaging 1.00
IGL02538:Krt2 APN 15 101811154 missense unknown
IGL02959:Krt2 APN 15 101811328 missense unknown
IGL03295:Krt2 APN 15 101816429 missense probably damaging 0.99
R0195:Krt2 UTSW 15 101813191 nonsense probably null
R0472:Krt2 UTSW 15 101813253 missense probably damaging 1.00
R0749:Krt2 UTSW 15 101817663 missense unknown
R0785:Krt2 UTSW 15 101817921 missense unknown
R0792:Krt2 UTSW 15 101816497 missense probably damaging 1.00
R1232:Krt2 UTSW 15 101811784 missense probably damaging 1.00
R1281:Krt2 UTSW 15 101813292 missense probably damaging 1.00
R1770:Krt2 UTSW 15 101811154 missense unknown
R1783:Krt2 UTSW 15 101813973 missense probably damaging 1.00
R1795:Krt2 UTSW 15 101816426 missense possibly damaging 0.85
R2283:Krt2 UTSW 15 101814387 missense probably damaging 1.00
R3977:Krt2 UTSW 15 101811127 missense unknown
R4575:Krt2 UTSW 15 101814486 missense probably damaging 1.00
R4619:Krt2 UTSW 15 101817591 missense probably damaging 1.00
R4620:Krt2 UTSW 15 101817591 missense probably damaging 1.00
R4766:Krt2 UTSW 15 101813960 missense probably damaging 1.00
R4819:Krt2 UTSW 15 101811544 missense unknown
R4953:Krt2 UTSW 15 101813942 missense probably damaging 1.00
R5108:Krt2 UTSW 15 101813286 missense possibly damaging 0.88
R5973:Krt2 UTSW 15 101816312 missense probably damaging 0.99
R6122:Krt2 UTSW 15 101815914 missense probably damaging 1.00
R6180:Krt2 UTSW 15 101815044 missense probably benign 0.05
R6661:Krt2 UTSW 15 101815963 missense probably damaging 1.00
R6974:Krt2 UTSW 15 101817879 missense unknown
R6993:Krt2 UTSW 15 101815960 missense probably damaging 1.00
R7104:Krt2 UTSW 15 101815087 missense probably benign 0.09
R7573:Krt2 UTSW 15 101814519 missense probably benign 0.05
R7947:Krt2 UTSW 15 101816334 missense probably damaging 1.00
R8469:Krt2 UTSW 15 101816369 missense probably benign 0.22
R8805:Krt2 UTSW 15 101815944 missense possibly damaging 0.93
R9051:Krt2 UTSW 15 101817882 missense unknown
R9230:Krt2 UTSW 15 101817513 missense probably benign 0.39
R9257:Krt2 UTSW 15 101816491 missense probably benign 0.05
R9424:Krt2 UTSW 15 101811357 missense unknown
R9569:Krt2 UTSW 15 101816489 missense probably damaging 1.00
R9576:Krt2 UTSW 15 101811357 missense unknown
RF020:Krt2 UTSW 15 101817968 missense unknown
Z1177:Krt2 UTSW 15 101811550 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TAGTGAAGCTCAGCTGTGTC -3'
(R):5'- ATGTGTGATGTCTCCTGCTC -3'

Sequencing Primer
(F):5'- AGCTGTGTCCCCCTATGG -3'
(R):5'- GTGATGTCTCCTGCTCCCCTTC -3'
Posted On 2021-12-30