Incidental Mutation 'R9119:Psg21'
ID 692680
Institutional Source Beutler Lab
Gene Symbol Psg21
Ensembl Gene ENSMUSG00000070796
Gene Name pregnancy-specific glycoprotein 21
Synonyms 1600026N13Rik, 1600019C01Rik, 1600025N01Rik, cea8
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.047) question?
Stock # R9119 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 18646736-18656725 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to G at 18647484 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Threonine at position 378 (K378T)
Ref Sequence ENSEMBL: ENSMUSP00000092387 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094793] [ENSMUST00000182128]
AlphaFold Q9DAV5
Predicted Effect probably benign
Transcript: ENSMUST00000094793
AA Change: K378T

PolyPhen 2 Score 0.137 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000092387
Gene: ENSMUSG00000070796
AA Change: K378T

DomainStartEndE-ValueType
IG 39 138 3.04e-3 SMART
IG 159 260 7.25e-1 SMART
IG 276 375 1.25e-4 SMART
IGc2 393 457 1.47e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000182128
SMART Domains Protein: ENSMUSP00000138173
Gene: ENSMUSG00000070796

DomainStartEndE-ValueType
IG 39 138 3.04e-3 SMART
IG 159 260 7.25e-1 SMART
IG 276 375 1.25e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (42/43)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310061I04Rik C G 17: 35,893,071 S185T probably benign Het
4932415D10Rik T C 10: 82,295,719 T486A probably benign Het
Aass A T 6: 23,094,001 M517K probably benign Het
Abcc4 A G 14: 118,631,030 V245A probably benign Het
Adgrv1 A G 13: 81,510,876 V2783A probably damaging Het
Anxa3 T A 5: 96,828,698 I181N Het
Ap4m1 T A 5: 138,176,041 probably benign Het
C1ql1 T A 11: 102,946,053 K137* probably null Het
Camkmt T A 17: 85,096,560 L70Q probably damaging Het
Ceacam18 T C 7: 43,639,485 L220P probably benign Het
Celsr2 C T 3: 108,401,972 A1656T possibly damaging Het
Dnah6 T C 6: 73,060,203 N3352S possibly damaging Het
Fbxo40 C A 16: 36,966,095 R704L probably damaging Het
Fcho1 C T 8: 71,712,068 G523E possibly damaging Het
Gas2l3 T C 10: 89,413,457 T600A possibly damaging Het
Ggh T A 4: 20,057,955 M172K probably damaging Het
Gm10184 T C 17: 89,910,193 K42E probably damaging Het
Gpr137 G A 19: 6,938,443 T373I probably benign Het
Mtnr1a G A 8: 45,087,966 M321I probably benign Het
Nebl T G 2: 17,400,559 N383T probably damaging Het
Nob1 A G 8: 107,416,144 S302P probably damaging Het
Ofcc1 A T 13: 40,180,540 H358Q probably benign Het
Olfr1414 G T 1: 92,511,182 T282K probably damaging Het
Pkd1l1 G A 11: 8,879,107 T1495I Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 109,624,195 probably benign Het
Plcb4 G A 2: 135,967,952 E609K probably damaging Het
Plxnd1 A T 6: 115,955,871 probably benign Het
Prdm2 G A 4: 143,131,879 Q1614* probably null Het
Ptprh T A 7: 4,552,713 N749I probably benign Het
Ric8b T G 10: 84,947,470 V64G possibly damaging Het
Sbf2 T C 7: 110,312,085 T1793A possibly damaging Het
Scgb1c1 A G 7: 140,846,222 H77R probably null Het
Sfswap C A 5: 129,514,765 T282N probably benign Het
Sorcs3 A T 19: 48,653,994 Y362F possibly damaging Het
Tpm4 A G 8: 72,138,681 N76D probably benign Het
Tpr T A 1: 150,404,002 L294Q probably damaging Het
Ttc3 C T 16: 94,392,091 T237I probably damaging Het
Tyw1 G A 5: 130,269,224 R202Q probably damaging Het
Ugt2a2 A G 5: 87,462,975 V334A probably damaging Het
Usp38 A T 8: 80,984,599 F936I probably damaging Het
Utp14b A G 1: 78,665,308 K308E probably damaging Het
Vmn2r19 C T 6: 123,315,568 P190S possibly damaging Het
Zbbx T C 3: 75,078,590 E385G probably damaging Het
Other mutations in Psg21
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01571:Psg21 APN 7 18654825 missense probably damaging 1.00
IGL02390:Psg21 APN 7 18652631 missense probably benign 0.11
IGL02548:Psg21 APN 7 18655036 missense possibly damaging 0.89
IGL03001:Psg21 APN 7 18652485 missense probably benign 0.03
IGL03135:Psg21 APN 7 18654918 missense probably benign 0.00
R0131:Psg21 UTSW 7 18654868 missense probably benign 0.39
R0551:Psg21 UTSW 7 18652640 critical splice acceptor site probably null
R1512:Psg21 UTSW 7 18656500 missense probably benign 0.00
R1874:Psg21 UTSW 7 18650816 missense probably benign 0.15
R1993:Psg21 UTSW 7 18654770 missense probably benign 0.04
R2327:Psg21 UTSW 7 18652453 missense possibly damaging 0.61
R3414:Psg21 UTSW 7 18652380 missense probably damaging 1.00
R4422:Psg21 UTSW 7 18647332 missense probably damaging 1.00
R5138:Psg21 UTSW 7 18656528 start codon destroyed probably null 0.94
R5623:Psg21 UTSW 7 18655014 missense probably damaging 1.00
R5686:Psg21 UTSW 7 18652258 intron probably benign
R6166:Psg21 UTSW 7 18656739 unclassified probably benign
R6177:Psg21 UTSW 7 18652354 missense possibly damaging 0.64
R6190:Psg21 UTSW 7 18655001 missense possibly damaging 0.61
R6210:Psg21 UTSW 7 18652345 missense probably damaging 1.00
R6482:Psg21 UTSW 7 18654739 splice site probably null
R6729:Psg21 UTSW 7 18652591 missense probably damaging 1.00
R6866:Psg21 UTSW 7 18652284 missense probably damaging 1.00
R6992:Psg21 UTSW 7 18654743 critical splice donor site probably null
R7075:Psg21 UTSW 7 18654861 missense probably damaging 1.00
R7081:Psg21 UTSW 7 18654849 nonsense probably null
R7098:Psg21 UTSW 7 18652545 missense probably damaging 1.00
R7582:Psg21 UTSW 7 18647203 makesense probably null
R7588:Psg21 UTSW 7 18647209 missense probably benign 0.00
R7607:Psg21 UTSW 7 18654783 missense probably benign 0.02
R7830:Psg21 UTSW 7 18647298 missense probably damaging 1.00
R7964:Psg21 UTSW 7 18647211 missense probably benign 0.01
R8758:Psg21 UTSW 7 18650753 missense probably damaging 1.00
R8972:Psg21 UTSW 7 18647368 missense probably benign 0.03
R8988:Psg21 UTSW 7 18652464 missense probably benign 0.00
R9446:Psg21 UTSW 7 18654940 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AAGGCCTCACATTGATACTCTCC -3'
(R):5'- GGCTGAGTCAGGATCATACAG -3'

Sequencing Primer
(F):5'- CCTCACAGTATGTATCCTGAGTTGG -3'
(R):5'- CTGAGTCAGGATCATACAGTTTGTAG -3'
Posted On 2021-12-30