Incidental Mutation 'R9119:Fcho1'
ID 692685
Institutional Source Beutler Lab
Gene Symbol Fcho1
Ensembl Gene ENSMUSG00000070000
Gene Name FCH domain only 1
Synonyms 3322402E17Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.164) question?
Stock # R9119 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 71708387-71725716 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 71712068 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glycine to Glutamic Acid at position 523 (G523E)
Ref Sequence ENSEMBL: ENSMUSP00000117606 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093444] [ENSMUST00000136640] [ENSMUST00000146100] [ENSMUST00000153800]
AlphaFold Q8K285
Predicted Effect possibly damaging
Transcript: ENSMUST00000093444
AA Change: G523E

PolyPhen 2 Score 0.873 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000091151
Gene: ENSMUSG00000070000
AA Change: G523E

DomainStartEndE-ValueType
FCH 6 92 2.05e-21 SMART
low complexity region 334 351 N/A INTRINSIC
low complexity region 364 382 N/A INTRINSIC
low complexity region 446 466 N/A INTRINSIC
low complexity region 567 576 N/A INTRINSIC
Pfam:muHD 610 872 4.9e-59 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000123425
SMART Domains Protein: ENSMUSP00000123631
Gene: ENSMUSG00000070000

DomainStartEndE-ValueType
low complexity region 52 70 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000136640
SMART Domains Protein: ENSMUSP00000119273
Gene: ENSMUSG00000070000

DomainStartEndE-ValueType
FCH 6 92 2.05e-21 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000146100
AA Change: G523E

PolyPhen 2 Score 0.873 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000117606
Gene: ENSMUSG00000070000
AA Change: G523E

DomainStartEndE-ValueType
FCH 6 92 2.05e-21 SMART
low complexity region 334 351 N/A INTRINSIC
low complexity region 364 382 N/A INTRINSIC
low complexity region 446 466 N/A INTRINSIC
low complexity region 567 576 N/A INTRINSIC
Pfam:muHD 610 872 1.4e-62 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000153800
SMART Domains Protein: ENSMUSP00000116135
Gene: ENSMUSG00000070000

DomainStartEndE-ValueType
FCH 6 92 2.05e-21 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (42/43)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310061I04Rik C G 17: 35,893,071 S185T probably benign Het
4932415D10Rik T C 10: 82,295,719 T486A probably benign Het
Aass A T 6: 23,094,001 M517K probably benign Het
Abcc4 A G 14: 118,631,030 V245A probably benign Het
Adgrv1 A G 13: 81,510,876 V2783A probably damaging Het
Anxa3 T A 5: 96,828,698 I181N Het
Ap4m1 T A 5: 138,176,041 probably benign Het
C1ql1 T A 11: 102,946,053 K137* probably null Het
Camkmt T A 17: 85,096,560 L70Q probably damaging Het
Ceacam18 T C 7: 43,639,485 L220P probably benign Het
Celsr2 C T 3: 108,401,972 A1656T possibly damaging Het
Dnah6 T C 6: 73,060,203 N3352S possibly damaging Het
Fbxo40 C A 16: 36,966,095 R704L probably damaging Het
Gas2l3 T C 10: 89,413,457 T600A possibly damaging Het
Ggh T A 4: 20,057,955 M172K probably damaging Het
Gm10184 T C 17: 89,910,193 K42E probably damaging Het
Gpr137 G A 19: 6,938,443 T373I probably benign Het
Mtnr1a G A 8: 45,087,966 M321I probably benign Het
Nebl T G 2: 17,400,559 N383T probably damaging Het
Nob1 A G 8: 107,416,144 S302P probably damaging Het
Ofcc1 A T 13: 40,180,540 H358Q probably benign Het
Olfr1414 G T 1: 92,511,182 T282K probably damaging Het
Pkd1l1 G A 11: 8,879,107 T1495I Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 109,624,195 probably benign Het
Plcb4 G A 2: 135,967,952 E609K probably damaging Het
Plxnd1 A T 6: 115,955,871 probably benign Het
Prdm2 G A 4: 143,131,879 Q1614* probably null Het
Psg21 T G 7: 18,647,484 K378T probably benign Het
Ptprh T A 7: 4,552,713 N749I probably benign Het
Ric8b T G 10: 84,947,470 V64G possibly damaging Het
Sbf2 T C 7: 110,312,085 T1793A possibly damaging Het
Scgb1c1 A G 7: 140,846,222 H77R probably null Het
Sfswap C A 5: 129,514,765 T282N probably benign Het
Sorcs3 A T 19: 48,653,994 Y362F possibly damaging Het
Tpm4 A G 8: 72,138,681 N76D probably benign Het
Tpr T A 1: 150,404,002 L294Q probably damaging Het
Ttc3 C T 16: 94,392,091 T237I probably damaging Het
Tyw1 G A 5: 130,269,224 R202Q probably damaging Het
Ugt2a2 A G 5: 87,462,975 V334A probably damaging Het
Usp38 A T 8: 80,984,599 F936I probably damaging Het
Utp14b A G 1: 78,665,308 K308E probably damaging Het
Vmn2r19 C T 6: 123,315,568 P190S possibly damaging Het
Zbbx T C 3: 75,078,590 E385G probably damaging Het
Other mutations in Fcho1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01021:Fcho1 APN 8 71713523 nonsense probably null
IGL01291:Fcho1 APN 8 71712547 missense probably benign 0.08
IGL01473:Fcho1 APN 8 71712138 missense probably benign 0.03
IGL02021:Fcho1 APN 8 71721275 missense probably benign 0.06
IGL02086:Fcho1 APN 8 71716800 missense probably damaging 1.00
IGL02808:Fcho1 APN 8 71712541 missense possibly damaging 0.89
IGL03146:Fcho1 APN 8 71717430 splice site probably benign
IGL03267:Fcho1 APN 8 71712299 unclassified probably benign
cameo UTSW 8 71716863 missense possibly damaging 0.92
Lesser UTSW 8 71712560 missense probably benign 0.00
Sidekick UTSW 8 71715725 missense probably damaging 1.00
ANU05:Fcho1 UTSW 8 71712547 missense probably benign 0.08
R0003:Fcho1 UTSW 8 71708953 missense probably damaging 1.00
R0010:Fcho1 UTSW 8 71709999 missense probably damaging 1.00
R0020:Fcho1 UTSW 8 71716870 missense probably benign 0.11
R0363:Fcho1 UTSW 8 71717490 missense probably damaging 1.00
R0457:Fcho1 UTSW 8 71712560 missense probably benign 0.00
R0485:Fcho1 UTSW 8 71712560 missense probably benign 0.00
R0501:Fcho1 UTSW 8 71712560 missense probably benign 0.00
R0502:Fcho1 UTSW 8 71712560 missense probably benign 0.00
R0551:Fcho1 UTSW 8 71712174 missense probably benign 0.06
R0583:Fcho1 UTSW 8 71715725 missense probably damaging 1.00
R0584:Fcho1 UTSW 8 71715725 missense probably damaging 1.00
R0585:Fcho1 UTSW 8 71715725 missense probably damaging 1.00
R0612:Fcho1 UTSW 8 71715524 missense probably damaging 1.00
R0614:Fcho1 UTSW 8 71712560 missense probably benign 0.00
R0647:Fcho1 UTSW 8 71712560 missense probably benign 0.00
R0841:Fcho1 UTSW 8 71712560 missense probably benign 0.00
R0842:Fcho1 UTSW 8 71712560 missense probably benign 0.00
R1034:Fcho1 UTSW 8 71712560 missense probably benign 0.00
R1036:Fcho1 UTSW 8 71712560 missense probably benign 0.00
R1399:Fcho1 UTSW 8 71712560 missense probably benign 0.00
R1466:Fcho1 UTSW 8 71712560 missense probably benign 0.00
R1466:Fcho1 UTSW 8 71712560 missense probably benign 0.00
R1618:Fcho1 UTSW 8 71710403 missense probably damaging 0.98
R1754:Fcho1 UTSW 8 71711246 missense probably benign
R1793:Fcho1 UTSW 8 71709022 nonsense probably null
R2073:Fcho1 UTSW 8 71710489 missense probably damaging 0.98
R2177:Fcho1 UTSW 8 71712261 missense probably damaging 1.00
R4072:Fcho1 UTSW 8 71710369 missense probably damaging 0.99
R4074:Fcho1 UTSW 8 71710369 missense probably damaging 0.99
R4076:Fcho1 UTSW 8 71710369 missense probably damaging 0.99
R4606:Fcho1 UTSW 8 71712480 missense probably benign
R4732:Fcho1 UTSW 8 71716795 missense probably benign 0.00
R4733:Fcho1 UTSW 8 71716795 missense probably benign 0.00
R4860:Fcho1 UTSW 8 71710481 missense probably benign 0.04
R4860:Fcho1 UTSW 8 71710481 missense probably benign 0.04
R5082:Fcho1 UTSW 8 71717185 missense possibly damaging 0.69
R5083:Fcho1 UTSW 8 71717176 missense probably benign 0.00
R5185:Fcho1 UTSW 8 71714956 unclassified probably benign
R6025:Fcho1 UTSW 8 71712573 splice site probably null
R6624:Fcho1 UTSW 8 71709371 missense probably damaging 0.99
R6875:Fcho1 UTSW 8 71714425 splice site probably null
R7069:Fcho1 UTSW 8 71710497 splice site probably null
R7476:Fcho1 UTSW 8 71713546 missense probably damaging 1.00
R7512:Fcho1 UTSW 8 71716863 missense possibly damaging 0.92
R7951:Fcho1 UTSW 8 71712276 missense probably benign 0.00
R8699:Fcho1 UTSW 8 71709633 missense possibly damaging 0.63
R8938:Fcho1 UTSW 8 71717146 missense possibly damaging 0.96
R9090:Fcho1 UTSW 8 71710424 missense possibly damaging 0.80
R9117:Fcho1 UTSW 8 71712068 missense possibly damaging 0.87
R9271:Fcho1 UTSW 8 71710424 missense possibly damaging 0.80
R9433:Fcho1 UTSW 8 71716824 missense probably benign 0.03
R9447:Fcho1 UTSW 8 71717269 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACATCTCCATCCATTGGTGGC -3'
(R):5'- TCCTCATCTCCGGAGAATGTG -3'

Sequencing Primer
(F):5'- ATCCATTGGTGGCCACAGGATC -3'
(R):5'- CTCCGGAGAATGTGGAGGACTC -3'
Posted On 2021-12-30