Incidental Mutation 'R9120:Olfr350'
ID 692707
Institutional Source Beutler Lab
Gene Symbol Olfr350
Ensembl Gene ENSMUSG00000050015
Gene Name olfactory receptor 350
Synonyms MOR136-13, GA_x6K02T2NLDC-33544602-33545540
Accession Numbers

Genbank: NM_146627; MGI: 3030184

Is this an essential gene? Probably non essential (E-score: 0.175) question?
Stock # R9120 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 36846310-36851702 bp(+) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) T to A at 36850131 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Stop codon at position 28 (Y28*)
Ref Sequence ENSEMBL: ENSMUSP00000150158 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055130] [ENSMUST00000214457] [ENSMUST00000215100]
AlphaFold Q8VFP8
Predicted Effect probably null
Transcript: ENSMUST00000055130
AA Change: Y28*
SMART Domains Protein: ENSMUSP00000053105
Gene: ENSMUSG00000050015
AA Change: Y28*

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 6.3e-61 PFAM
Pfam:7TM_GPCR_Srsx 35 305 1.3e-7 PFAM
Pfam:7tm_1 41 290 3e-24 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000214457
AA Change: Y28*
Predicted Effect probably null
Transcript: ENSMUST00000215100
AA Change: Y28*
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb2 A G 4: 130,012,509 N910S possibly damaging Het
Arhgap24 A T 5: 102,892,150 I411F probably benign Het
BC030500 T A 8: 58,912,877 L15Q unknown Het
BC051665 A G 13: 60,785,102 V15A probably benign Het
Bicc1 T C 10: 70,941,032 D732G probably damaging Het
Bpifb1 A G 2: 154,204,772 I71V probably benign Het
Btnl1 A T 17: 34,379,707 Q99L possibly damaging Het
D7Ertd443e T A 7: 134,270,257 D625V probably damaging Het
Dchs2 A T 3: 83,280,228 D1327V probably damaging Het
Ddx1 A G 12: 13,225,457 V543A possibly damaging Het
Dgkz G T 2: 91,938,200 D714E probably benign Het
Dlk1 A G 12: 109,458,125 D105G probably benign Het
Fndc3a A G 14: 72,564,693 F557L probably benign Het
Gatsl3 T A 11: 4,220,767 V196D possibly damaging Het
Gm28042 C T 2: 120,038,981 L609F probably damaging Het
Gsap A G 5: 21,253,436 I473V probably damaging Het
Jag1 A T 2: 137,088,434 M730K probably benign Het
Kazald1 A T 19: 45,076,772 T31S probably benign Het
Ldhb A G 6: 142,494,209 W202R probably damaging Het
Lrrcc1 C T 3: 14,550,429 Q528* probably null Het
Magi2 A T 5: 20,528,307 K525I possibly damaging Het
Map2 A G 1: 66,414,059 I703V probably damaging Het
Mdn1 A T 4: 32,701,814 M1516L probably damaging Het
Mpzl2 T A 9: 45,047,285 S186R probably benign Het
Mtif2 T C 11: 29,533,951 M208T probably benign Het
Myo3a T C 2: 22,544,426 V873A probably benign Het
Olfr1166 A G 2: 88,124,779 S69P probably damaging Het
Olfr455 A C 6: 42,538,649 Y124* probably null Het
Olfr478 T C 7: 108,031,680 Y221C probably damaging Het
Olfr919 A G 9: 38,697,439 F309S probably benign Het
Plod2 G T 9: 92,542,327 probably benign Het
Rgs14 A C 13: 55,380,979 D311A probably damaging Het
Rin1 C A 19: 5,053,020 P446T probably damaging Het
Ripor3 T C 2: 167,980,915 K909E possibly damaging Het
Rnf139 T C 15: 58,899,836 L570P probably damaging Het
Snx17 A G 5: 31,197,682 E347G probably damaging Het
Spaca1 A G 4: 34,029,168 S220P probably damaging Het
Spen G T 4: 141,472,922 T2798K Het
Tacc1 G T 8: 25,169,239 S570R probably damaging Het
Tmem135 G C 7: 89,147,978 L357V probably benign Het
Tmem246 A G 4: 49,587,093 V25A probably benign Het
Trmt2a C A 16: 18,249,858 R132S probably damaging Het
Ttn T C 2: 76,938,372 E2952G unknown Het
Tyw1 G A 5: 130,269,224 R202Q probably damaging Het
Vmn1r211 A T 13: 22,851,766 F244I probably damaging Het
Vmn2r86 T G 10: 130,453,808 S73R probably benign Het
Wdr27 A G 17: 14,932,584 L87P probably damaging Het
Zfp148 A G 16: 33,497,226 N756S probably benign Het
Zfp57 G A 17: 37,009,758 R168H probably benign Het
Other mutations in Olfr350
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01068:Olfr350 APN 2 36850270 missense probably damaging 1.00
IGL01113:Olfr350 APN 2 36850619 missense probably damaging 1.00
IGL01393:Olfr350 APN 2 36850541 missense probably benign 0.01
IGL02302:Olfr350 APN 2 36850703 missense probably benign 0.02
IGL02316:Olfr350 APN 2 36850282 missense probably damaging 1.00
BB007:Olfr350 UTSW 2 36850273 missense probably damaging 1.00
BB017:Olfr350 UTSW 2 36850273 missense probably damaging 1.00
F6893:Olfr350 UTSW 2 36850807 missense probably benign 0.00
PIT4402001:Olfr350 UTSW 2 36850304 missense probably benign
R0312:Olfr350 UTSW 2 36850360 missense probably benign 0.01
R0525:Olfr350 UTSW 2 36850190 missense probably damaging 1.00
R0557:Olfr350 UTSW 2 36850748 missense possibly damaging 0.95
R0665:Olfr350 UTSW 2 36850190 missense probably damaging 1.00
R2019:Olfr350 UTSW 2 36850406 missense possibly damaging 0.95
R2107:Olfr350 UTSW 2 36850343 missense possibly damaging 0.54
R2108:Olfr350 UTSW 2 36850343 missense possibly damaging 0.54
R2848:Olfr350 UTSW 2 36850799 missense probably damaging 1.00
R3964:Olfr350 UTSW 2 36850717 missense probably benign 0.12
R4822:Olfr350 UTSW 2 36850876 missense probably benign 0.10
R4907:Olfr350 UTSW 2 36850258 missense probably benign 0.28
R5134:Olfr350 UTSW 2 36850476 missense probably benign 0.03
R5144:Olfr350 UTSW 2 36850144 missense probably benign
R5702:Olfr350 UTSW 2 36850934 missense probably damaging 1.00
R5727:Olfr350 UTSW 2 36850532 missense possibly damaging 0.80
R5786:Olfr350 UTSW 2 36850049 start codon destroyed probably null 0.98
R6179:Olfr350 UTSW 2 36850834 missense possibly damaging 0.59
R6862:Olfr350 UTSW 2 36850222 missense possibly damaging 0.95
R7258:Olfr350 UTSW 2 36850340 missense probably damaging 0.99
R7307:Olfr350 UTSW 2 36850125 missense probably benign 0.00
R7353:Olfr350 UTSW 2 36850069 missense probably benign
R7412:Olfr350 UTSW 2 36850466 missense probably benign 0.28
R7851:Olfr350 UTSW 2 36850416 nonsense probably null
R7930:Olfr350 UTSW 2 36850273 missense probably damaging 1.00
R8005:Olfr350 UTSW 2 36850144 missense probably benign
R8346:Olfr350 UTSW 2 36850339 missense probably benign 0.02
R8692:Olfr350 UTSW 2 36850084 missense probably benign 0.00
R9318:Olfr350 UTSW 2 36850553 missense probably benign 0.12
Z1177:Olfr350 UTSW 2 36850239 missense probably damaging 0.99
Z1177:Olfr350 UTSW 2 36850925 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGGTGCAACCCACTTTAAATGG -3'
(R):5'- ATTCCTCAGCATCTTGGGTAC -3'

Sequencing Primer
(F):5'- CCCACTTTAAATGGCTGAATAATACC -3'
(R):5'- CTCAGCATCTTGGGTACAGTGAC -3'
Posted On 2021-12-30