Incidental Mutation 'R9120:Plod2'
ID 692736
Institutional Source Beutler Lab
Gene Symbol Plod2
Ensembl Gene ENSMUSG00000032374
Gene Name procollagen lysine, 2-oxoglutarate 5-dioxygenase 2
Synonyms D530025C14Rik, Plod-2, LH2, lysyl hydroxylase 2
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9120 (G1)
Quality Score 155.008
Status Validated
Chromosome 9
Chromosomal Location 92542223-92608428 bp(+) (GRCm38)
Type of Mutation start gained
DNA Base Change (assembly) G to T at 92542327 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000125373 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070522] [ENSMUST00000160359]
AlphaFold Q9R0B9
Predicted Effect probably benign
Transcript: ENSMUST00000070522
SMART Domains Protein: ENSMUSP00000068611
Gene: ENSMUSG00000032374

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 181 193 N/A INTRINSIC
low complexity region 307 321 N/A INTRINSIC
Blast:P4Hc 453 500 1e-22 BLAST
P4Hc 563 736 6.38e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160359
SMART Domains Protein: ENSMUSP00000125373
Gene: ENSMUSG00000032374

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 181 193 N/A INTRINSIC
low complexity region 307 321 N/A INTRINSIC
Blast:P4Hc 453 500 1e-22 BLAST
P4Hc 584 757 6.38e-21 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (54/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a membrane-bound homodimeric enzyme that is localized to the cisternae of the rough endoplasmic reticulum. The enzyme (cofactors iron and ascorbate) catalyzes the hydroxylation of lysyl residues in collagen-like peptides. The resultant hydroxylysyl groups are attachment sites for carbohydrates in collagen and thus are critical for the stability of intermolecular crosslinks. Some patients with Ehlers-Danlos syndrome type VIB have deficiencies in lysyl hydroxylase activity. Mutations in the coding region of this gene are associated with Bruck syndrome. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam25 A G 8: 40,756,104 probably benign Het
Adgrb2 A G 4: 130,012,509 N910S possibly damaging Het
Arhgap24 A T 5: 102,892,150 I411F probably benign Het
BC030500 T A 8: 58,912,877 L15Q unknown Het
BC051665 A G 13: 60,785,102 V15A probably benign Het
Bicc1 T C 10: 70,941,032 D732G probably damaging Het
Bpifb1 A G 2: 154,204,772 I71V probably benign Het
Btnl1 A T 17: 34,379,707 Q99L possibly damaging Het
Col9a2 G T 4: 121,043,754 probably benign Het
D7Ertd443e T A 7: 134,270,257 D625V probably damaging Het
Dchs2 A T 3: 83,280,228 D1327V probably damaging Het
Ddx1 A G 12: 13,225,457 V543A possibly damaging Het
Dgkz G T 2: 91,938,200 D714E probably benign Het
Dlk1 A G 12: 109,458,125 D105G probably benign Het
Fndc3a A G 14: 72,564,693 F557L probably benign Het
Gatsl3 T A 11: 4,220,767 V196D possibly damaging Het
Gm28042 C T 2: 120,038,981 L609F probably damaging Het
Gsap A G 5: 21,253,436 I473V probably damaging Het
Jag1 A T 2: 137,088,434 M730K probably benign Het
Kazald1 A T 19: 45,076,772 T31S probably benign Het
Ldhb A G 6: 142,494,209 W202R probably damaging Het
Lrrcc1 C T 3: 14,550,429 Q528* probably null Het
Magi2 A T 5: 20,528,307 K525I possibly damaging Het
Map2 A G 1: 66,414,059 I703V probably damaging Het
Mdn1 A T 4: 32,701,814 M1516L probably damaging Het
Mpzl2 T A 9: 45,047,285 S186R probably benign Het
Mtif2 T C 11: 29,533,951 M208T probably benign Het
Myo3a T C 2: 22,544,426 V873A probably benign Het
Olfr1166 A G 2: 88,124,779 S69P probably damaging Het
Olfr350 T A 2: 36,850,131 Y28* probably null Het
Olfr455 A C 6: 42,538,649 Y124* probably null Het
Olfr478 T C 7: 108,031,680 Y221C probably damaging Het
Olfr919 A G 9: 38,697,439 F309S probably benign Het
Rgs14 A C 13: 55,380,979 D311A probably damaging Het
Rin1 C A 19: 5,053,020 P446T probably damaging Het
Ripor3 T C 2: 167,980,915 K909E possibly damaging Het
Rnf139 T C 15: 58,899,836 L570P probably damaging Het
Snx17 A G 5: 31,197,682 E347G probably damaging Het
Spaca1 A G 4: 34,029,168 S220P probably damaging Het
Spen G T 4: 141,472,922 T2798K Het
Tacc1 G T 8: 25,169,239 S570R probably damaging Het
Tmem135 G C 7: 89,147,978 L357V probably benign Het
Tmem246 A G 4: 49,587,093 V25A probably benign Het
Trim63 G A 4: 134,327,692 probably benign Het
Trmt2a C A 16: 18,249,858 R132S probably damaging Het
Ttn T C 2: 76,938,372 E2952G unknown Het
Tyw1 G A 5: 130,269,224 R202Q probably damaging Het
Vmn1r211 A T 13: 22,851,766 F244I probably damaging Het
Vmn2r86 T G 10: 130,453,808 S73R probably benign Het
Wdr27 A G 17: 14,932,584 L87P probably damaging Het
Zfp148 A G 16: 33,497,226 N756S probably benign Het
Zfp57 G A 17: 37,009,758 R168H probably benign Het
Other mutations in Plod2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00715:Plod2 APN 9 92598614 missense probably damaging 0.99
IGL00945:Plod2 APN 9 92584496 missense probably benign 0.08
IGL01386:Plod2 APN 9 92606602 missense probably damaging 0.99
IGL01519:Plod2 APN 9 92595295 missense probably benign 0.00
IGL01836:Plod2 APN 9 92606498 splice site probably benign
IGL02490:Plod2 APN 9 92586842 missense probably benign 0.00
IGL02496:Plod2 APN 9 92607094 missense probably damaging 1.00
IGL02699:Plod2 APN 9 92607142 missense probably damaging 1.00
IGL02735:Plod2 APN 9 92595389 splice site probably benign
IGL03106:Plod2 APN 9 92573567 missense probably damaging 0.98
R0270:Plod2 UTSW 9 92584521 missense probably benign 0.10
R0546:Plod2 UTSW 9 92595335 missense probably damaging 1.00
R0589:Plod2 UTSW 9 92593746 missense probably benign
R0707:Plod2 UTSW 9 92605427 missense possibly damaging 0.91
R1491:Plod2 UTSW 9 92606584 missense probably benign 0.00
R1572:Plod2 UTSW 9 92603067 splice site probably benign
R1731:Plod2 UTSW 9 92584604 critical splice donor site probably null
R1895:Plod2 UTSW 9 92607135 missense probably damaging 1.00
R1917:Plod2 UTSW 9 92581257 missense probably benign
R1946:Plod2 UTSW 9 92607135 missense probably damaging 1.00
R3850:Plod2 UTSW 9 92542545 missense probably benign 0.28
R3973:Plod2 UTSW 9 92598619 nonsense probably null
R3974:Plod2 UTSW 9 92598619 nonsense probably null
R4289:Plod2 UTSW 9 92602988 missense possibly damaging 0.89
R4423:Plod2 UTSW 9 92601989 missense probably benign 0.00
R4647:Plod2 UTSW 9 92605450 nonsense probably null
R4754:Plod2 UTSW 9 92606531 nonsense probably null
R4769:Plod2 UTSW 9 92595272 missense probably damaging 1.00
R5279:Plod2 UTSW 9 92581323 missense probably damaging 1.00
R5535:Plod2 UTSW 9 92606569 missense probably damaging 1.00
R5654:Plod2 UTSW 9 92593823 missense probably benign
R5764:Plod2 UTSW 9 92603021 missense probably damaging 0.97
R5885:Plod2 UTSW 9 92606656 critical splice donor site probably null
R5940:Plod2 UTSW 9 92591397 missense probably benign 0.39
R6917:Plod2 UTSW 9 92593770 missense possibly damaging 0.87
R7109:Plod2 UTSW 9 92573597 missense probably damaging 1.00
R7221:Plod2 UTSW 9 92584527 missense probably damaging 1.00
R7311:Plod2 UTSW 9 92584558 missense probably damaging 1.00
R7963:Plod2 UTSW 9 92605446 missense probably benign 0.07
R8205:Plod2 UTSW 9 92542318 start gained probably benign
R8794:Plod2 UTSW 9 92600748 missense probably damaging 0.98
R8873:Plod2 UTSW 9 92607059 intron probably benign
R9044:Plod2 UTSW 9 92607220 missense probably damaging 0.97
R9071:Plod2 UTSW 9 92602995 missense probably benign 0.09
Z1088:Plod2 UTSW 9 92603035 missense probably benign
Predicted Primers PCR Primer
(F):5'- TTCCACAAGCAAGCTCCCTG -3'
(R):5'- AACATGCCCAGTTCTCTCTAGACC -3'

Sequencing Primer
(F):5'- TGAGGCGGTGCACGTAG -3'
(R):5'- AGTTCTCTCTAGACCGCCGG -3'
Posted On 2021-12-30