Incidental Mutation 'R9121:Slc44a3'
ID 692768
Institutional Source Beutler Lab
Gene Symbol Slc44a3
Ensembl Gene ENSMUSG00000039865
Gene Name solute carrier family 44, member 3
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9121 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 121459528-121532404 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 121461137 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 611 (S611P)
Ref Sequence ENSEMBL: ENSMUSP00000040210 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029773] [ENSMUST00000039197] [ENSMUST00000197135] [ENSMUST00000198393]
AlphaFold Q921V7
Predicted Effect probably benign
Transcript: ENSMUST00000029773
SMART Domains Protein: ENSMUSP00000029773
Gene: ENSMUSG00000053931

DomainStartEndE-ValueType
CH 28 125 3.92e-27 SMART
Pfam:Calponin 164 188 1.1e-19 PFAM
Pfam:Calponin 204 228 7.4e-17 PFAM
Pfam:Calponin 243 267 1.8e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000039197
AA Change: S611P

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000040210
Gene: ENSMUSG00000039865
AA Change: S611P

DomainStartEndE-ValueType
transmembrane domain 37 59 N/A INTRINSIC
transmembrane domain 217 239 N/A INTRINSIC
transmembrane domain 244 266 N/A INTRINSIC
Pfam:Choline_transpo 291 607 2.3e-80 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000197135
SMART Domains Protein: ENSMUSP00000142526
Gene: ENSMUSG00000053931

DomainStartEndE-ValueType
CH 28 120 8.6e-10 SMART
Pfam:Calponin 158 183 1e-10 PFAM
Pfam:Calponin 197 222 9.6e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000198393
SMART Domains Protein: ENSMUSP00000143186
Gene: ENSMUSG00000053931

DomainStartEndE-ValueType
Blast:CH 1 28 7e-12 BLAST
SCOP:d1h67a_ 1 35 9e-9 SMART
PDB:1WYN|A 1 53 3e-21 PDB
Pfam:Calponin 67 92 1.2e-14 PFAM
Pfam:Calponin 107 132 3.8e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000198620
Predicted Effect probably benign
Transcript: ENSMUST00000199499
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy2 A T 13: 68,671,959 N720K probably benign Het
Ampd1 C T 3: 103,098,682 Q603* probably null Het
Arap2 G A 5: 62,748,983 T231M possibly damaging Het
Atp2b4 TCT TCTGCT 1: 133,701,725 probably benign Het
Cap1 C T 4: 122,867,723 R122Q probably damaging Het
Cdh10 G A 15: 19,010,988 V586M probably damaging Het
Clvs2 A T 10: 33,513,335 V303E possibly damaging Het
Cnnm3 C A 1: 36,524,077 C707* probably null Het
Crtc3 A G 7: 80,592,575 F497L probably damaging Het
Csmd3 T C 15: 47,820,378 Y949C Het
D5Ertd579e A T 5: 36,615,434 I539N probably damaging Het
Dctpp1 T C 7: 127,257,284 R89G probably damaging Het
Dnah7c T A 1: 46,665,490 V2221E probably damaging Het
Dnah7c C A 1: 46,777,736 L3628I probably benign Het
E030025P04Rik A G 11: 109,143,912 F50S unknown Het
Edrf1 CGG CG 7: 133,657,041 probably null Het
Epb41l1 T G 2: 156,522,567 S999A probably benign Het
Fbxw10 T A 11: 62,847,327 C16S possibly damaging Het
Fbxw19 G A 9: 109,495,822 P9L probably damaging Het
Gpi1 A T 7: 34,207,689 Y327N probably damaging Het
Hook3 A G 8: 26,035,167 L637P probably damaging Het
Idh3a T C 9: 54,586,545 probably null Het
Ighv1-56 T A 12: 115,243,014 T47S probably benign Het
Iglc2 A C 16: 19,198,544 C103G probably damaging Het
Mbd5 A G 2: 49,258,090 T771A possibly damaging Het
Mcm2 C A 6: 88,884,037 R893L probably benign Het
Mettl15 A T 2: 109,274,603 V19E Het
Mier2 G A 10: 79,541,760 A453V Het
Mlf1 T C 3: 67,399,721 S255P probably benign Het
Obsl1 T C 1: 75,505,992 D78G possibly damaging Het
Olfr1137 T A 2: 87,711,631 I92F probably damaging Het
Olfr922 T A 9: 38,815,680 M59K probably damaging Het
Otof T C 5: 30,379,118 K1340E probably benign Het
Pla2g4c A G 7: 13,357,085 D589G probably damaging Het
Qrfpr A G 3: 36,181,007 V278A probably damaging Het
Rnaset2a A G 17: 8,128,717 F250S possibly damaging Het
Sfrp5 T C 19: 42,201,917 Y32C probably damaging Het
Slco1a1 C A 6: 141,946,816 probably benign Het
Synj2 A T 17: 5,990,324 D225V probably damaging Het
Tacc1 G T 8: 25,169,239 S570R probably damaging Het
Trim7 T A 11: 48,849,847 L257Q probably damaging Het
Trpm8 T A 1: 88,384,701 N1101K probably benign Het
Unc79 C T 12: 103,001,836 T107M probably damaging Het
Usp54 A G 14: 20,581,455 probably null Het
Zzef1 T A 11: 72,866,120 Y1150* probably null Het
Other mutations in Slc44a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01327:Slc44a3 APN 3 121527193 missense probably damaging 1.00
IGL01527:Slc44a3 APN 3 121527128 missense probably damaging 1.00
IGL02304:Slc44a3 APN 3 121527074 missense possibly damaging 0.48
IGL02419:Slc44a3 APN 3 121490257 missense probably benign 0.03
IGL02836:Slc44a3 APN 3 121531717 missense probably damaging 1.00
IGL02937:Slc44a3 APN 3 121510321 splice site probably benign
IGL03219:Slc44a3 APN 3 121463520 missense probably damaging 1.00
BB009:Slc44a3 UTSW 3 121512360 missense possibly damaging 0.86
BB019:Slc44a3 UTSW 3 121512360 missense possibly damaging 0.86
R0597:Slc44a3 UTSW 3 121460070 missense probably benign
R0668:Slc44a3 UTSW 3 121510203 missense probably damaging 0.96
R1355:Slc44a3 UTSW 3 121531671 missense probably damaging 1.00
R1608:Slc44a3 UTSW 3 121497847 nonsense probably null
R1617:Slc44a3 UTSW 3 121461265 missense probably benign 0.19
R1912:Slc44a3 UTSW 3 121532166 missense probably benign 0.00
R2027:Slc44a3 UTSW 3 121463410 splice site probably benign
R2087:Slc44a3 UTSW 3 121525670 missense probably damaging 0.99
R2199:Slc44a3 UTSW 3 121513744 missense probably benign 0.02
R4707:Slc44a3 UTSW 3 121527074 missense possibly damaging 0.48
R4736:Slc44a3 UTSW 3 121510206 missense probably damaging 0.97
R4784:Slc44a3 UTSW 3 121527074 missense possibly damaging 0.48
R4785:Slc44a3 UTSW 3 121527074 missense possibly damaging 0.48
R5302:Slc44a3 UTSW 3 121510313 missense probably damaging 1.00
R5835:Slc44a3 UTSW 3 121527200 missense probably benign 0.03
R6252:Slc44a3 UTSW 3 121513737 missense probably damaging 0.99
R6991:Slc44a3 UTSW 3 121532165 missense probably benign 0.01
R7197:Slc44a3 UTSW 3 121525762 missense probably benign 0.02
R7227:Slc44a3 UTSW 3 121510230 missense possibly damaging 0.93
R7272:Slc44a3 UTSW 3 121461115 missense probably damaging 0.99
R7932:Slc44a3 UTSW 3 121512360 missense possibly damaging 0.86
R8104:Slc44a3 UTSW 3 121497872 missense probably benign 0.01
R8529:Slc44a3 UTSW 3 121525685 missense probably benign 0.36
R8679:Slc44a3 UTSW 3 121490269 missense probably damaging 1.00
R8856:Slc44a3 UTSW 3 121513807 missense probably damaging 1.00
R9053:Slc44a3 UTSW 3 121527190 missense probably damaging 1.00
R9360:Slc44a3 UTSW 3 121532259 start gained probably benign
Z1176:Slc44a3 UTSW 3 121532251 start gained probably benign
Z1177:Slc44a3 UTSW 3 121497750 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- ATTCTCACCTCTGGACTGGG -3'
(R):5'- TGATGGCGTTTAACTACAGCC -3'

Sequencing Primer
(F):5'- GAAATGGTTCCTCGTCTGACAGC -3'
(R):5'- GTTTAACTACAGCCGTGCG -3'
Posted On 2021-12-30