Incidental Mutation 'R9121:Edrf1'
ID 692779
Institutional Source Beutler Lab
Gene Symbol Edrf1
Ensembl Gene ENSMUSG00000039990
Gene Name erythroid differentiation regulatory factor 1
Synonyms 2700050L05Rik
MMRRC Submission
Accession Numbers
Essential gene? Probably essential (E-score: 0.945) question?
Stock # R9121 (G1)
Quality Score 217.468
Status Validated
Chromosome 7
Chromosomal Location 133239422-133274710 bp(+) (GRCm39)
Type of Mutation frame shift
DNA Base Change (assembly) CGG to CG at 133258770 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000059166 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051169] [ENSMUST00000128901] [ENSMUST00000138370]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000051169
SMART Domains Protein: ENSMUSP00000059166
Gene: ENSMUSG00000039990

DomainStartEndE-ValueType
low complexity region 8 29 N/A INTRINSIC
low complexity region 116 128 N/A INTRINSIC
low complexity region 219 237 N/A INTRINSIC
low complexity region 254 264 N/A INTRINSIC
low complexity region 467 477 N/A INTRINSIC
low complexity region 529 549 N/A INTRINSIC
low complexity region 1171 1184 N/A INTRINSIC
low complexity region 1229 1237 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000128901
SMART Domains Protein: ENSMUSP00000115641
Gene: ENSMUSG00000039990

DomainStartEndE-ValueType
low complexity region 8 29 N/A INTRINSIC
low complexity region 116 128 N/A INTRINSIC
low complexity region 219 237 N/A INTRINSIC
low complexity region 254 264 N/A INTRINSIC
low complexity region 433 443 N/A INTRINSIC
low complexity region 495 515 N/A INTRINSIC
low complexity region 1137 1150 N/A INTRINSIC
low complexity region 1195 1203 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000138370
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene may play a role in erythroid cell differentiation. The encoded protein inhibits DNA binding of the erythroid transcription factor GATA-1 and may regulate the expression of alpha-globin and gamma-globin. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2014]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy2 A T 13: 68,820,078 (GRCm39) N720K probably benign Het
Ampd1 C T 3: 103,005,998 (GRCm39) Q603* probably null Het
Arap2 G A 5: 62,906,326 (GRCm39) T231M possibly damaging Het
Atp2b4 TCT TCTGCT 1: 133,629,463 (GRCm39) probably benign Het
Cap1 C T 4: 122,761,516 (GRCm39) R122Q probably damaging Het
Cdh10 G A 15: 19,011,074 (GRCm39) V586M probably damaging Het
Clvs2 A T 10: 33,389,331 (GRCm39) V303E possibly damaging Het
Cnnm3 C A 1: 36,563,158 (GRCm39) C707* probably null Het
Crtc3 A G 7: 80,242,323 (GRCm39) F497L probably damaging Het
Csmd3 T C 15: 47,683,774 (GRCm39) Y949C Het
D5Ertd579e A T 5: 36,772,778 (GRCm39) I539N probably damaging Het
Dctpp1 T C 7: 126,856,456 (GRCm39) R89G probably damaging Het
Dnah7c T A 1: 46,704,650 (GRCm39) V2221E probably damaging Het
Dnah7c C A 1: 46,816,896 (GRCm39) L3628I probably benign Het
E030025P04Rik A G 11: 109,034,738 (GRCm39) F50S unknown Het
Epb41l1 T G 2: 156,364,487 (GRCm39) S999A probably benign Het
Fbxw10 T A 11: 62,738,153 (GRCm39) C16S possibly damaging Het
Fbxw19 G A 9: 109,324,890 (GRCm39) P9L probably damaging Het
Gpi1 A T 7: 33,907,114 (GRCm39) Y327N probably damaging Het
Hook3 A G 8: 26,525,195 (GRCm39) L637P probably damaging Het
Idh3a T C 9: 54,493,829 (GRCm39) probably null Het
Ighv1-56 T A 12: 115,206,634 (GRCm39) T47S probably benign Het
Iglc2 A C 16: 19,017,294 (GRCm39) C103G probably damaging Het
Mbd5 A G 2: 49,148,102 (GRCm39) T771A possibly damaging Het
Mcm2 C A 6: 88,861,019 (GRCm39) R893L probably benign Het
Mettl15 A T 2: 109,104,948 (GRCm39) V19E Het
Mier2 G A 10: 79,377,594 (GRCm39) A453V Het
Mlf1 T C 3: 67,307,054 (GRCm39) S255P probably benign Het
Obsl1 T C 1: 75,482,636 (GRCm39) D78G possibly damaging Het
Or5w14 T A 2: 87,541,975 (GRCm39) I92F probably damaging Het
Or8b55 T A 9: 38,726,976 (GRCm39) M59K probably damaging Het
Otof T C 5: 30,536,462 (GRCm39) K1340E probably benign Het
Pla2g4c A G 7: 13,091,010 (GRCm39) D589G probably damaging Het
Qrfpr A G 3: 36,235,156 (GRCm39) V278A probably damaging Het
Qrich2 T A 11: 116,347,272 (GRCm39) H1184L unknown Het
Rnaset2a A G 17: 8,347,549 (GRCm39) F250S possibly damaging Het
Sfrp5 T C 19: 42,190,356 (GRCm39) Y32C probably damaging Het
Slc44a3 A G 3: 121,254,786 (GRCm39) S611P probably benign Het
Slco1a1 C A 6: 141,892,542 (GRCm39) probably benign Het
Synj2 A T 17: 6,040,599 (GRCm39) D225V probably damaging Het
Tacc1 G T 8: 25,659,255 (GRCm39) S570R probably damaging Het
Trim7 T A 11: 48,740,674 (GRCm39) L257Q probably damaging Het
Trpm8 T A 1: 88,312,423 (GRCm39) N1101K probably benign Het
Unc79 C T 12: 102,968,095 (GRCm39) T107M probably damaging Het
Usp54 A G 14: 20,631,523 (GRCm39) probably null Het
Zzef1 T A 11: 72,756,946 (GRCm39) Y1150* probably null Het
Other mutations in Edrf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01111:Edrf1 APN 7 133,260,282 (GRCm39) nonsense probably null
IGL01637:Edrf1 APN 7 133,252,254 (GRCm39) missense probably damaging 1.00
IGL01697:Edrf1 APN 7 133,245,459 (GRCm39) missense probably benign 0.02
IGL01893:Edrf1 APN 7 133,258,831 (GRCm39) missense probably benign 0.09
IGL02202:Edrf1 APN 7 133,258,699 (GRCm39) missense probably benign 0.00
IGL02278:Edrf1 APN 7 133,258,729 (GRCm39) missense probably benign 0.00
IGL02382:Edrf1 APN 7 133,252,344 (GRCm39) splice site probably benign
IGL02743:Edrf1 APN 7 133,258,220 (GRCm39) unclassified probably benign
R0265:Edrf1 UTSW 7 133,258,774 (GRCm39) missense probably damaging 1.00
R0282:Edrf1 UTSW 7 133,245,751 (GRCm39) missense probably benign 0.21
R1167:Edrf1 UTSW 7 133,245,795 (GRCm39) missense probably benign 0.08
R1633:Edrf1 UTSW 7 133,253,869 (GRCm39) missense probably damaging 1.00
R2039:Edrf1 UTSW 7 133,255,678 (GRCm39) nonsense probably null
R2060:Edrf1 UTSW 7 133,258,858 (GRCm39) nonsense probably null
R2920:Edrf1 UTSW 7 133,269,301 (GRCm39) missense probably benign 0.00
R4770:Edrf1 UTSW 7 133,260,339 (GRCm39) missense probably damaging 0.99
R4887:Edrf1 UTSW 7 133,260,339 (GRCm39) missense probably damaging 0.99
R4888:Edrf1 UTSW 7 133,260,339 (GRCm39) missense probably damaging 0.99
R5135:Edrf1 UTSW 7 133,252,773 (GRCm39) missense probably benign 0.03
R5156:Edrf1 UTSW 7 133,261,908 (GRCm39) missense probably damaging 1.00
R5290:Edrf1 UTSW 7 133,252,295 (GRCm39) missense probably damaging 0.98
R5342:Edrf1 UTSW 7 133,253,639 (GRCm39) splice site probably null
R5416:Edrf1 UTSW 7 133,243,131 (GRCm39) missense possibly damaging 0.52
R5450:Edrf1 UTSW 7 133,260,339 (GRCm39) missense probably damaging 0.99
R5906:Edrf1 UTSW 7 133,265,144 (GRCm39) missense probably benign
R6272:Edrf1 UTSW 7 133,239,537 (GRCm39) start gained probably benign
R6275:Edrf1 UTSW 7 133,269,311 (GRCm39) missense possibly damaging 0.60
R7144:Edrf1 UTSW 7 133,239,578 (GRCm39) missense probably benign
R7244:Edrf1 UTSW 7 133,256,079 (GRCm39) missense probably benign 0.01
R7716:Edrf1 UTSW 7 133,245,455 (GRCm39) missense probably damaging 0.99
R8193:Edrf1 UTSW 7 133,263,606 (GRCm39) missense possibly damaging 0.95
R8197:Edrf1 UTSW 7 133,249,088 (GRCm39) missense probably benign 0.41
R8553:Edrf1 UTSW 7 133,252,047 (GRCm39) missense possibly damaging 0.88
R8710:Edrf1 UTSW 7 133,245,495 (GRCm39) missense probably damaging 1.00
R8839:Edrf1 UTSW 7 133,255,644 (GRCm39) missense probably benign 0.00
R9035:Edrf1 UTSW 7 133,245,431 (GRCm39) missense probably damaging 0.97
R9051:Edrf1 UTSW 7 133,273,207 (GRCm39) missense probably benign 0.00
R9396:Edrf1 UTSW 7 133,261,838 (GRCm39) missense possibly damaging 0.79
R9551:Edrf1 UTSW 7 133,240,742 (GRCm39) missense probably damaging 1.00
R9552:Edrf1 UTSW 7 133,240,742 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAAGAATGTGAAGCCCTGTGC -3'
(R):5'- CCTGACACTTTTGCAGCATAC -3'

Sequencing Primer
(F):5'- TGAAGCCCTGTGCCACCTG -3'
(R):5'- TACTCCCTGAGCTGAACAGATTATC -3'
Posted On 2021-12-30