Incidental Mutation 'R9121:Edrf1'
ID 692779
Institutional Source Beutler Lab
Gene Symbol Edrf1
Ensembl Gene ENSMUSG00000039990
Gene Name erythroid differentiation regulatory factor 1
Synonyms 2700050L05Rik
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.637) question?
Stock # R9121 (G1)
Quality Score 217.468
Status Not validated
Chromosome 7
Chromosomal Location 133637543-133672971 bp(+) (GRCm38)
Type of Mutation frame shift
DNA Base Change (assembly) CGG to CG at 133657041 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000059166 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051169] [ENSMUST00000128901] [ENSMUST00000138370]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000051169
SMART Domains Protein: ENSMUSP00000059166
Gene: ENSMUSG00000039990

DomainStartEndE-ValueType
low complexity region 8 29 N/A INTRINSIC
low complexity region 116 128 N/A INTRINSIC
low complexity region 219 237 N/A INTRINSIC
low complexity region 254 264 N/A INTRINSIC
low complexity region 467 477 N/A INTRINSIC
low complexity region 529 549 N/A INTRINSIC
low complexity region 1171 1184 N/A INTRINSIC
low complexity region 1229 1237 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000128901
SMART Domains Protein: ENSMUSP00000115641
Gene: ENSMUSG00000039990

DomainStartEndE-ValueType
low complexity region 8 29 N/A INTRINSIC
low complexity region 116 128 N/A INTRINSIC
low complexity region 219 237 N/A INTRINSIC
low complexity region 254 264 N/A INTRINSIC
low complexity region 433 443 N/A INTRINSIC
low complexity region 495 515 N/A INTRINSIC
low complexity region 1137 1150 N/A INTRINSIC
low complexity region 1195 1203 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000138370
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene may play a role in erythroid cell differentiation. The encoded protein inhibits DNA binding of the erythroid transcription factor GATA-1 and may regulate the expression of alpha-globin and gamma-globin. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2014]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy2 A T 13: 68,671,959 N720K probably benign Het
Ampd1 C T 3: 103,098,682 Q603* probably null Het
Arap2 G A 5: 62,748,983 T231M possibly damaging Het
Atp2b4 TCT TCTGCT 1: 133,701,725 probably benign Het
Cap1 C T 4: 122,867,723 R122Q probably damaging Het
Cdh10 G A 15: 19,010,988 V586M probably damaging Het
Clvs2 A T 10: 33,513,335 V303E possibly damaging Het
Cnnm3 C A 1: 36,524,077 C707* probably null Het
Crtc3 A G 7: 80,592,575 F497L probably damaging Het
Csmd3 T C 15: 47,820,378 Y949C Het
D5Ertd579e A T 5: 36,615,434 I539N probably damaging Het
Dctpp1 T C 7: 127,257,284 R89G probably damaging Het
Dnah7c T A 1: 46,665,490 V2221E probably damaging Het
Dnah7c C A 1: 46,777,736 L3628I probably benign Het
E030025P04Rik A G 11: 109,143,912 F50S unknown Het
Epb41l1 T G 2: 156,522,567 S999A probably benign Het
Fbxw10 T A 11: 62,847,327 C16S possibly damaging Het
Fbxw19 G A 9: 109,495,822 P9L probably damaging Het
Gpi1 A T 7: 34,207,689 Y327N probably damaging Het
Hook3 A G 8: 26,035,167 L637P probably damaging Het
Idh3a T C 9: 54,586,545 probably null Het
Ighv1-56 T A 12: 115,243,014 T47S probably benign Het
Iglc2 A C 16: 19,198,544 C103G probably damaging Het
Mbd5 A G 2: 49,258,090 T771A possibly damaging Het
Mcm2 C A 6: 88,884,037 R893L probably benign Het
Mettl15 A T 2: 109,274,603 V19E Het
Mier2 G A 10: 79,541,760 A453V Het
Mlf1 T C 3: 67,399,721 S255P probably benign Het
Obsl1 T C 1: 75,505,992 D78G possibly damaging Het
Olfr1137 T A 2: 87,711,631 I92F probably damaging Het
Olfr922 T A 9: 38,815,680 M59K probably damaging Het
Otof T C 5: 30,379,118 K1340E probably benign Het
Pla2g4c A G 7: 13,357,085 D589G probably damaging Het
Qrfpr A G 3: 36,181,007 V278A probably damaging Het
Rnaset2a A G 17: 8,128,717 F250S possibly damaging Het
Sfrp5 T C 19: 42,201,917 Y32C probably damaging Het
Slc44a3 A G 3: 121,461,137 S611P probably benign Het
Slco1a1 C A 6: 141,946,816 probably benign Het
Synj2 A T 17: 5,990,324 D225V probably damaging Het
Tacc1 G T 8: 25,169,239 S570R probably damaging Het
Trim7 T A 11: 48,849,847 L257Q probably damaging Het
Trpm8 T A 1: 88,384,701 N1101K probably benign Het
Unc79 C T 12: 103,001,836 T107M probably damaging Het
Usp54 A G 14: 20,581,455 probably null Het
Zzef1 T A 11: 72,866,120 Y1150* probably null Het
Other mutations in Edrf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01111:Edrf1 APN 7 133658553 nonsense probably null
IGL01637:Edrf1 APN 7 133650525 missense probably damaging 1.00
IGL01697:Edrf1 APN 7 133643730 missense probably benign 0.02
IGL01893:Edrf1 APN 7 133657102 missense probably benign 0.09
IGL02202:Edrf1 APN 7 133656970 missense probably benign 0.00
IGL02278:Edrf1 APN 7 133657000 missense probably benign 0.00
IGL02382:Edrf1 APN 7 133650615 splice site probably benign
IGL02743:Edrf1 APN 7 133656491 unclassified probably benign
R0265:Edrf1 UTSW 7 133657045 missense probably damaging 1.00
R0282:Edrf1 UTSW 7 133644022 missense probably benign 0.21
R1167:Edrf1 UTSW 7 133644066 missense probably benign 0.08
R1633:Edrf1 UTSW 7 133652140 missense probably damaging 1.00
R2039:Edrf1 UTSW 7 133653949 nonsense probably null
R2060:Edrf1 UTSW 7 133657129 nonsense probably null
R2920:Edrf1 UTSW 7 133667572 missense probably benign 0.00
R4770:Edrf1 UTSW 7 133658610 missense probably damaging 0.99
R4887:Edrf1 UTSW 7 133658610 missense probably damaging 0.99
R4888:Edrf1 UTSW 7 133658610 missense probably damaging 0.99
R5135:Edrf1 UTSW 7 133651044 missense probably benign 0.03
R5156:Edrf1 UTSW 7 133660179 missense probably damaging 1.00
R5290:Edrf1 UTSW 7 133650566 missense probably damaging 0.98
R5342:Edrf1 UTSW 7 133651910 splice site probably null
R5416:Edrf1 UTSW 7 133641402 missense possibly damaging 0.52
R5450:Edrf1 UTSW 7 133658610 missense probably damaging 0.99
R5906:Edrf1 UTSW 7 133663415 missense probably benign
R6272:Edrf1 UTSW 7 133637808 start gained probably benign
R6275:Edrf1 UTSW 7 133667582 missense possibly damaging 0.60
R7144:Edrf1 UTSW 7 133637849 missense probably benign
R7244:Edrf1 UTSW 7 133654350 missense probably benign 0.01
R7716:Edrf1 UTSW 7 133643726 missense probably damaging 0.99
R8193:Edrf1 UTSW 7 133661877 missense possibly damaging 0.95
R8197:Edrf1 UTSW 7 133647359 missense probably benign 0.41
R8553:Edrf1 UTSW 7 133650318 missense possibly damaging 0.88
R8710:Edrf1 UTSW 7 133643766 missense probably damaging 1.00
R8839:Edrf1 UTSW 7 133653915 missense probably benign 0.00
R9035:Edrf1 UTSW 7 133643702 missense probably damaging 0.97
R9051:Edrf1 UTSW 7 133671478 missense probably benign 0.00
R9396:Edrf1 UTSW 7 133660109 missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- GAAGAATGTGAAGCCCTGTGC -3'
(R):5'- CCTGACACTTTTGCAGCATAC -3'

Sequencing Primer
(F):5'- TGAAGCCCTGTGCCACCTG -3'
(R):5'- TACTCCCTGAGCTGAACAGATTATC -3'
Posted On 2021-12-30