Incidental Mutation 'R9121:Hook3'
ID 692781
Institutional Source Beutler Lab
Gene Symbol Hook3
Ensembl Gene ENSMUSG00000037234
Gene Name hook microtubule tethering protein 3
Synonyms E330005F07Rik, 5830454D03Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9121 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 26021421-26119224 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 26035167 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 637 (L637P)
Ref Sequence ENSEMBL: ENSMUSP00000046788 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037182] [ENSMUST00000147613]
AlphaFold Q8BUK6
Predicted Effect probably damaging
Transcript: ENSMUST00000037182
AA Change: L637P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000046788
Gene: ENSMUSG00000037234
AA Change: L637P

DomainStartEndE-ValueType
Pfam:HOOK 12 710 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147613
SMART Domains Protein: ENSMUSP00000115008
Gene: ENSMUSG00000037234

DomainStartEndE-ValueType
Pfam:HOOK 1 194 1.1e-75 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000211683
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Hook proteins are cytosolic coiled-coil proteins that contain conserved N-terminal domains, which attach to microtubules, and more divergent C-terminal domains, which mediate binding to organelles. The Drosophila Hook protein is a component of the endocytic compartment.[supplied by OMIM, Apr 2004]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy2 A T 13: 68,671,959 N720K probably benign Het
Ampd1 C T 3: 103,098,682 Q603* probably null Het
Arap2 G A 5: 62,748,983 T231M possibly damaging Het
Atp2b4 TCT TCTGCT 1: 133,701,725 probably benign Het
Cap1 C T 4: 122,867,723 R122Q probably damaging Het
Cdh10 G A 15: 19,010,988 V586M probably damaging Het
Clvs2 A T 10: 33,513,335 V303E possibly damaging Het
Cnnm3 C A 1: 36,524,077 C707* probably null Het
Crtc3 A G 7: 80,592,575 F497L probably damaging Het
Csmd3 T C 15: 47,820,378 Y949C Het
D5Ertd579e A T 5: 36,615,434 I539N probably damaging Het
Dctpp1 T C 7: 127,257,284 R89G probably damaging Het
Dnah7c T A 1: 46,665,490 V2221E probably damaging Het
Dnah7c C A 1: 46,777,736 L3628I probably benign Het
E030025P04Rik A G 11: 109,143,912 F50S unknown Het
Edrf1 CGG CG 7: 133,657,041 probably null Het
Epb41l1 T G 2: 156,522,567 S999A probably benign Het
Fbxw10 T A 11: 62,847,327 C16S possibly damaging Het
Fbxw19 G A 9: 109,495,822 P9L probably damaging Het
Gpi1 A T 7: 34,207,689 Y327N probably damaging Het
Idh3a T C 9: 54,586,545 probably null Het
Ighv1-56 T A 12: 115,243,014 T47S probably benign Het
Iglc2 A C 16: 19,198,544 C103G probably damaging Het
Mbd5 A G 2: 49,258,090 T771A possibly damaging Het
Mcm2 C A 6: 88,884,037 R893L probably benign Het
Mettl15 A T 2: 109,274,603 V19E Het
Mier2 G A 10: 79,541,760 A453V Het
Mlf1 T C 3: 67,399,721 S255P probably benign Het
Obsl1 T C 1: 75,505,992 D78G possibly damaging Het
Olfr1137 T A 2: 87,711,631 I92F probably damaging Het
Olfr922 T A 9: 38,815,680 M59K probably damaging Het
Otof T C 5: 30,379,118 K1340E probably benign Het
Pla2g4c A G 7: 13,357,085 D589G probably damaging Het
Qrfpr A G 3: 36,181,007 V278A probably damaging Het
Qrich2 T A 11: 116,456,446 H1184L unknown Het
Rnaset2a A G 17: 8,128,717 F250S possibly damaging Het
Sfrp5 T C 19: 42,201,917 Y32C probably damaging Het
Slc44a3 A G 3: 121,461,137 S611P probably benign Het
Slco1a1 C A 6: 141,946,816 probably benign Het
Synj2 A T 17: 5,990,324 D225V probably damaging Het
Tacc1 G T 8: 25,169,239 S570R probably damaging Het
Trim7 T A 11: 48,849,847 L257Q probably damaging Het
Trpm8 T A 1: 88,384,701 N1101K probably benign Het
Unc79 C T 12: 103,001,836 T107M probably damaging Het
Usp54 A G 14: 20,581,455 probably null Het
Zzef1 T A 11: 72,866,120 Y1150* probably null Het
Other mutations in Hook3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00695:Hook3 APN 8 26059250 missense possibly damaging 0.46
IGL01066:Hook3 APN 8 26048298 missense probably damaging 1.00
IGL01145:Hook3 APN 8 26059344 missense probably benign 0.00
IGL01514:Hook3 APN 8 26088189 missense possibly damaging 0.69
IGL01727:Hook3 APN 8 26070159 missense probably benign 0.00
IGL01832:Hook3 APN 8 26072365 missense possibly damaging 0.87
IGL01874:Hook3 APN 8 26039732 missense possibly damaging 0.71
IGL01931:Hook3 APN 8 26088055 splice site probably benign
IGL01948:Hook3 APN 8 26059312 missense possibly damaging 0.95
IGL02209:Hook3 APN 8 26070265 missense probably damaging 0.99
IGL02675:Hook3 APN 8 26061434 missense possibly damaging 0.64
IGL02750:Hook3 APN 8 26095754 splice site probably benign
Rufio UTSW 8 26034940 nonsense probably null
R0384:Hook3 UTSW 8 26044235 splice site probably null
R0600:Hook3 UTSW 8 26118986 missense probably benign
R1037:Hook3 UTSW 8 26072350 missense possibly damaging 0.92
R1413:Hook3 UTSW 8 26038106 missense probably damaging 0.98
R1563:Hook3 UTSW 8 26110752 missense probably benign 0.06
R1767:Hook3 UTSW 8 26071056 critical splice donor site probably null
R1806:Hook3 UTSW 8 26068659 missense probably damaging 1.00
R2025:Hook3 UTSW 8 26038098 missense probably damaging 0.96
R2026:Hook3 UTSW 8 26038098 missense probably damaging 0.96
R2027:Hook3 UTSW 8 26038098 missense probably damaging 0.96
R2091:Hook3 UTSW 8 26059394 splice site probably benign
R2153:Hook3 UTSW 8 26070197 missense probably damaging 1.00
R2184:Hook3 UTSW 8 26118983 missense probably benign 0.00
R4586:Hook3 UTSW 8 26032011 missense probably damaging 0.98
R4863:Hook3 UTSW 8 26038029 missense probably damaging 1.00
R4971:Hook3 UTSW 8 26082579 missense probably benign 0.22
R5023:Hook3 UTSW 8 26032019 frame shift probably null
R5026:Hook3 UTSW 8 26110757 missense probably damaging 0.98
R5068:Hook3 UTSW 8 26095757 critical splice donor site probably null
R5253:Hook3 UTSW 8 26072291 missense probably benign
R5383:Hook3 UTSW 8 26118989 missense probably benign 0.01
R5437:Hook3 UTSW 8 26061422 missense probably benign 0.05
R5528:Hook3 UTSW 8 26072293 missense probably damaging 1.00
R5551:Hook3 UTSW 8 26068611 missense possibly damaging 0.75
R5846:Hook3 UTSW 8 26044327 intron probably benign
R5907:Hook3 UTSW 8 26044278 intron probably benign
R6082:Hook3 UTSW 8 26110785 missense probably benign 0.00
R6124:Hook3 UTSW 8 26059272 missense probably benign 0.20
R6301:Hook3 UTSW 8 26034940 nonsense probably null
R6314:Hook3 UTSW 8 26088108 missense probably benign
R6448:Hook3 UTSW 8 26093664 missense probably benign 0.02
R6810:Hook3 UTSW 8 26032422 splice site probably null
R7168:Hook3 UTSW 8 26071086 missense probably benign 0.02
R7856:Hook3 UTSW 8 26035221 missense probably damaging 1.00
R7988:Hook3 UTSW 8 26073647 missense probably benign 0.02
R8079:Hook3 UTSW 8 26088058 critical splice donor site probably null
R9223:Hook3 UTSW 8 26032524 missense
R9244:Hook3 UTSW 8 26071056 critical splice donor site probably null
R9246:Hook3 UTSW 8 26072291 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGGCACTAACAATGTATTTCTCCTCC -3'
(R):5'- AGATGCTAGATTCTTAGCGTTTGAG -3'

Sequencing Primer
(F):5'- AACAATGTATTTCTCCTCCATGTCTC -3'
(R):5'- GGTTATCCGTACATTAGACC -3'
Posted On 2021-12-30