Incidental Mutation 'R9122:Ddx31'
ID 692802
Institutional Source Beutler Lab
Gene Symbol Ddx31
Ensembl Gene ENSMUSG00000026806
Gene Name DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 31
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.805) question?
Stock # R9122 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 28840406-28905571 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 28858741 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Glutamine at position 227 (R227Q)
Ref Sequence ENSEMBL: ENSMUSP00000109484 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113853]
AlphaFold Q6NZQ2
Predicted Effect probably damaging
Transcript: ENSMUST00000113853
AA Change: R227Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109484
Gene: ENSMUSG00000026806
AA Change: R227Q

DomainStartEndE-ValueType
DEXDc 123 332 2.28e-48 SMART
HELICc 408 487 4.02e-26 SMART
DUF4217 556 621 6.21e-22 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.7%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this DEAD box protein family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. This gene encodes a member of this family. The function of this member has not been determined. Alternative splicing of this gene generates multiple transcript variants encoding different isoforms. [provided by RefSeq, Apr 2016]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310061I04Rik C G 17: 35,893,071 S185T probably benign Het
3632451O06Rik A T 14: 49,774,002 Y83N possibly damaging Het
Bean1 CT C 8: 104,182,032 probably null Het
Cacna1d C A 14: 30,123,445 R611L probably damaging Het
Cacna1d G A 14: 30,130,168 T498I probably benign Het
Cc2d2a T A 5: 43,673,739 D57E probably null Het
Cd180 C A 13: 102,705,009 L188M probably damaging Het
Chd7 A G 4: 8,840,510 K1426R possibly damaging Het
Cntnap5c A T 17: 58,104,606 D495V probably benign Het
Col11a1 T A 3: 114,113,600 M630K unknown Het
Cxxc1 T G 18: 74,217,175 D4E probably benign Het
Ddx60 A G 8: 61,989,864 M1109V probably benign Het
Dennd5b T C 6: 149,006,742 T1018A Het
Ggta1 A T 2: 35,413,324 probably null Het
Gm11639 A T 11: 104,965,779 D3840V unknown Het
Gm40460 CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 142,240,817 probably benign Het
Gpr37l1 C T 1: 135,167,471 V12I probably benign Het
Grin2a A T 16: 9,579,322 V967E possibly damaging Het
Helz A G 11: 107,666,004 T1283A probably benign Het
Hist3h2a T C 11: 58,954,841 L35P probably damaging Het
Ints1 A G 5: 139,760,175 M1315T possibly damaging Het
Klri1 T A 6: 129,717,032 R31* probably null Het
Nadk T A 4: 155,586,818 N226K probably benign Het
Ncapg T C 5: 45,688,673 F624S possibly damaging Het
Nxn A T 11: 76,278,491 I154N probably damaging Het
Pclo T C 5: 14,679,984 V2952A unknown Het
Poc1a T C 9: 106,285,043 V89A probably benign Het
Pou2f2 T A 7: 25,092,877 T518S probably benign Het
Pou5f1 C T 17: 35,509,056 T7I probably benign Het
Prss44 T C 9: 110,817,294 V363A probably damaging Het
Rhobtb1 T C 10: 69,270,823 V468A probably damaging Het
Slc24a1 C A 9: 64,927,196 M981I probably benign Het
Tacc1 G T 8: 25,169,239 S570R probably damaging Het
Tcrg-V1 G A 13: 19,340,160 G18E probably damaging Het
Tle3 C T 9: 61,407,473 probably benign Het
Tmem135 G C 7: 89,147,978 L357V probably benign Het
Trim23 A G 13: 104,181,173 T61A probably benign Het
Tshr C A 12: 91,511,963 H195N probably benign Het
Ttn A G 2: 76,881,807 S8202P unknown Het
Ufsp2 A T 8: 45,985,404 Y248F probably benign Het
Vmn2r12 T A 5: 109,093,044 I68L probably benign Het
Wdfy3 C A 5: 101,943,965 V503L probably damaging Het
Zfp788 A T 7: 41,650,495 K852* probably null Het
Zfp980 A C 4: 145,702,264 H521P probably damaging Het
Other mutations in Ddx31
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01664:Ddx31 APN 2 28875835 splice site probably benign
IGL01918:Ddx31 APN 2 28874164 missense probably damaging 1.00
IGL02174:Ddx31 APN 2 28859029 missense probably damaging 1.00
IGL02560:Ddx31 APN 2 28875826 missense probably damaging 1.00
IGL02938:Ddx31 APN 2 28859023 missense possibly damaging 0.49
R0241:Ddx31 UTSW 2 28848291 missense probably damaging 1.00
R0241:Ddx31 UTSW 2 28848291 missense probably damaging 1.00
R0440:Ddx31 UTSW 2 28857132 missense probably damaging 1.00
R0701:Ddx31 UTSW 2 28858777 missense probably null 1.00
R0729:Ddx31 UTSW 2 28874174 missense probably damaging 1.00
R1227:Ddx31 UTSW 2 28857175 missense probably damaging 1.00
R1532:Ddx31 UTSW 2 28881159 missense probably benign 0.00
R1608:Ddx31 UTSW 2 28859066 missense probably damaging 0.97
R1646:Ddx31 UTSW 2 28892520 missense probably benign
R1674:Ddx31 UTSW 2 28858816 missense probably damaging 1.00
R1834:Ddx31 UTSW 2 28892453 missense probably damaging 1.00
R1884:Ddx31 UTSW 2 28858990 missense probably damaging 0.97
R4133:Ddx31 UTSW 2 28858852 missense probably damaging 1.00
R4911:Ddx31 UTSW 2 28904684 missense probably benign 0.00
R4972:Ddx31 UTSW 2 28860770 missense probably damaging 1.00
R5240:Ddx31 UTSW 2 28846030 missense probably benign 0.03
R5358:Ddx31 UTSW 2 28863770 missense probably damaging 0.98
R5450:Ddx31 UTSW 2 28886969 missense probably damaging 0.97
R5945:Ddx31 UTSW 2 28859890 missense probably damaging 1.00
R5956:Ddx31 UTSW 2 28874173 missense probably damaging 1.00
R6235:Ddx31 UTSW 2 28844842 missense probably benign 0.00
R6245:Ddx31 UTSW 2 28844982 missense probably benign 0.00
R6463:Ddx31 UTSW 2 28847513 critical splice donor site probably null
R6647:Ddx31 UTSW 2 28875738 missense probably damaging 1.00
R6783:Ddx31 UTSW 2 28874176 missense probably benign 0.26
R6917:Ddx31 UTSW 2 28892409 missense probably damaging 1.00
R7135:Ddx31 UTSW 2 28848306 missense probably benign
R7819:Ddx31 UTSW 2 28892451 missense probably damaging 1.00
R8812:Ddx31 UTSW 2 28840804 unclassified probably benign
R9326:Ddx31 UTSW 2 28858996 missense probably damaging 1.00
R9571:Ddx31 UTSW 2 28860022 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGTAAGGGTTATGGTTCCGTATATC -3'
(R):5'- ATACTACCAGGCCACAGGTC -3'

Sequencing Primer
(F):5'- TTTACATCTTAGCAGTTCTATACGC -3'
(R):5'- CTGTCCTGGAGATGGCAGGAC -3'
Posted On 2021-12-30