Incidental Mutation 'R9073:Spen'
ID 692862
Institutional Source Beutler Lab
Gene Symbol Spen
Ensembl Gene ENSMUSG00000040761
Gene Name spen family transcription repressor
Synonyms Mint
MMRRC Submission
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R9073 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 141195201-141265908 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 141203702 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 1642 (T1642A)
Ref Sequence ENSEMBL: ENSMUSP00000101412 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078886] [ENSMUST00000105786]
AlphaFold no structure available at present
Predicted Effect unknown
Transcript: ENSMUST00000078886
AA Change: T1619A
SMART Domains Protein: ENSMUSP00000077925
Gene: ENSMUSG00000040761
AA Change: T1619A

DomainStartEndE-ValueType
RRM 7 77 7.77e-12 SMART
low complexity region 109 121 N/A INTRINSIC
low complexity region 235 257 N/A INTRINSIC
low complexity region 262 311 N/A INTRINSIC
RRM 338 411 8.6e-5 SMART
RRM 441 511 1.56e-16 SMART
RRM 520 587 1.84e-13 SMART
low complexity region 617 632 N/A INTRINSIC
low complexity region 669 691 N/A INTRINSIC
low complexity region 695 720 N/A INTRINSIC
low complexity region 749 773 N/A INTRINSIC
coiled coil region 800 825 N/A INTRINSIC
low complexity region 830 841 N/A INTRINSIC
internal_repeat_2 844 954 6.27e-5 PROSPERO
coiled coil region 1494 1522 N/A INTRINSIC
low complexity region 1587 1627 N/A INTRINSIC
low complexity region 1635 1641 N/A INTRINSIC
low complexity region 1642 1671 N/A INTRINSIC
low complexity region 1747 1758 N/A INTRINSIC
low complexity region 1810 1823 N/A INTRINSIC
low complexity region 1888 1903 N/A INTRINSIC
low complexity region 1940 1955 N/A INTRINSIC
low complexity region 2003 2012 N/A INTRINSIC
internal_repeat_2 2015 2115 6.27e-5 PROSPERO
low complexity region 2127 2147 N/A INTRINSIC
low complexity region 2169 2191 N/A INTRINSIC
low complexity region 2207 2219 N/A INTRINSIC
low complexity region 2304 2323 N/A INTRINSIC
low complexity region 2332 2371 N/A INTRINSIC
low complexity region 2396 2413 N/A INTRINSIC
low complexity region 2518 2533 N/A INTRINSIC
low complexity region 2545 2555 N/A INTRINSIC
low complexity region 2696 2722 N/A INTRINSIC
low complexity region 2931 2942 N/A INTRINSIC
low complexity region 2994 3006 N/A INTRINSIC
low complexity region 3192 3212 N/A INTRINSIC
low complexity region 3299 3337 N/A INTRINSIC
Pfam:SPOC 3465 3586 2.7e-29 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000105786
AA Change: T1642A
SMART Domains Protein: ENSMUSP00000101412
Gene: ENSMUSG00000040761
AA Change: T1642A

DomainStartEndE-ValueType
RRM 7 77 7.77e-12 SMART
low complexity region 109 121 N/A INTRINSIC
low complexity region 235 257 N/A INTRINSIC
low complexity region 262 311 N/A INTRINSIC
RRM 338 411 8.6e-5 SMART
RRM 441 511 1.56e-16 SMART
RRM 520 587 1.84e-13 SMART
low complexity region 692 714 N/A INTRINSIC
low complexity region 718 743 N/A INTRINSIC
low complexity region 772 796 N/A INTRINSIC
coiled coil region 823 848 N/A INTRINSIC
low complexity region 853 864 N/A INTRINSIC
internal_repeat_2 867 977 8.58e-5 PROSPERO
coiled coil region 1517 1545 N/A INTRINSIC
low complexity region 1610 1650 N/A INTRINSIC
low complexity region 1658 1664 N/A INTRINSIC
low complexity region 1665 1694 N/A INTRINSIC
low complexity region 1770 1781 N/A INTRINSIC
low complexity region 1833 1846 N/A INTRINSIC
low complexity region 1911 1926 N/A INTRINSIC
low complexity region 1963 1978 N/A INTRINSIC
low complexity region 2026 2035 N/A INTRINSIC
internal_repeat_2 2038 2138 8.58e-5 PROSPERO
low complexity region 2150 2170 N/A INTRINSIC
low complexity region 2192 2214 N/A INTRINSIC
low complexity region 2230 2242 N/A INTRINSIC
low complexity region 2327 2346 N/A INTRINSIC
low complexity region 2355 2394 N/A INTRINSIC
low complexity region 2419 2436 N/A INTRINSIC
low complexity region 2541 2556 N/A INTRINSIC
low complexity region 2568 2578 N/A INTRINSIC
low complexity region 2719 2745 N/A INTRINSIC
low complexity region 2954 2965 N/A INTRINSIC
low complexity region 3017 3029 N/A INTRINSIC
low complexity region 3215 3235 N/A INTRINSIC
low complexity region 3322 3360 N/A INTRINSIC
Pfam:SPOC 3488 3609 2.7e-29 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 99% (79/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a hormone inducible transcriptional repressor. Repression of transcription by this gene product can occur through interactions with other repressors, by the recruitment of proteins involved in histone deacetylation, or through sequestration of transcriptional activators. The product of this gene contains a carboxy-terminal domain that permits binding to other corepressor proteins. This domain also permits interaction with members of the NuRD complex, a nucleosome remodeling protein complex that contains deacetylase activity. In addition, this repressor contains several RNA recognition motifs that confer binding to a steroid receptor RNA coactivator; this binding can modulate the activity of both liganded and nonliganded steroid receptors. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice die during late gestation exhibiting morphological abnormalities of the heart, pancreas, and liver. Inactivation of this gene also affects the differentiation of B cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aak1 T A 6: 86,921,374 (GRCm39) Y190* probably null Het
Agbl3 T C 6: 34,776,387 (GRCm39) C298R probably damaging Het
Ankrd26 T A 6: 118,500,350 (GRCm39) K1040N probably damaging Het
Ano3 T A 2: 110,576,243 (GRCm39) T93S probably benign Het
Apoc3 T A 9: 46,144,532 (GRCm39) I97F probably benign Het
Arid5a A G 1: 36,358,626 (GRCm39) E401G probably benign Het
Atxn3 T C 12: 101,903,730 (GRCm39) probably null Het
Brca1 C T 11: 101,393,306 (GRCm39) probably null Het
C1ql3 T A 2: 13,015,198 (GRCm39) N154I probably damaging Het
Calcoco2 GGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC GGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC 11: 95,990,808 (GRCm39) probably benign Het
Ccdc110 A T 8: 46,395,875 (GRCm39) M589L probably benign Het
Ccnb2 A T 9: 70,318,095 (GRCm39) F226I possibly damaging Het
Clasp1 C A 1: 118,390,193 (GRCm39) probably null Het
Commd8 TTGTCATCT TT 5: 72,318,327 (GRCm39) probably null Het
Dis3 T C 14: 99,332,647 (GRCm39) T262A probably benign Het
Eif4a2 G A 16: 22,929,403 (GRCm39) R234Q probably benign Het
Ephx2 G A 14: 66,323,688 (GRCm39) R481* probably null Het
Fbxo15 T C 18: 84,983,645 (GRCm39) I331T possibly damaging Het
Gfra2 A G 14: 71,138,935 (GRCm39) E121G possibly damaging Het
Git1 G A 11: 77,389,901 (GRCm39) A55T probably benign Het
Gm12887 G T 4: 121,479,238 (GRCm39) probably null Het
Hfm1 T C 5: 107,046,146 (GRCm39) I553V probably benign Het
Hydin G A 8: 110,994,083 (GRCm39) probably null Het
Iqgap3 A G 3: 88,016,773 (GRCm39) N1085S Het
Kbtbd12 T C 6: 88,595,422 (GRCm39) Y136C probably damaging Het
Kcng3 A G 17: 83,938,423 (GRCm39) Y209H possibly damaging Het
Kcnj2 A T 11: 110,962,664 (GRCm39) M19L possibly damaging Het
Lonrf2 A T 1: 38,850,867 (GRCm39) F232I probably damaging Het
Lrrc31 T C 3: 30,753,859 (GRCm39) D14G probably benign Het
Ly6l G A 15: 75,321,585 (GRCm39) V62I possibly damaging Het
Marchf8 T C 6: 116,378,884 (GRCm39) F273L probably benign Het
Masp1 A C 16: 23,288,671 (GRCm39) S710A probably benign Het
Mcm10 G A 2: 5,013,414 (GRCm39) R73C possibly damaging Het
Mcm5 G A 8: 75,852,934 (GRCm39) R682H probably damaging Het
Mink1 C T 11: 70,499,207 (GRCm39) T684I possibly damaging Het
Mocos A T 18: 24,797,089 (GRCm39) Q83L probably damaging Het
Nags T C 11: 102,038,347 (GRCm39) L351P probably damaging Het
Nalcn G A 14: 123,532,863 (GRCm39) T1299I possibly damaging Het
Nlrp4b A G 7: 10,459,870 (GRCm39) D824G probably benign Het
Nwd1 A T 8: 73,422,046 (GRCm39) M1031L probably benign Het
Or11g27 C T 14: 50,771,211 (GRCm39) T114I probably benign Het
Or4c101 A C 2: 88,390,658 (GRCm39) I271L probably benign Het
Or4k40 A T 2: 111,250,705 (GRCm39) I197N possibly damaging Het
Or56b1 C T 7: 104,285,291 (GRCm39) R137C probably benign Het
Or5b112 A G 19: 13,319,238 (GRCm39) T39A possibly damaging Het
Or5d37 T A 2: 87,924,172 (GRCm39) Q36L probably benign Het
Pan2 T C 10: 128,151,050 (GRCm39) M807T probably damaging Het
Parp8 A T 13: 117,047,951 (GRCm39) I222N probably damaging Het
Pmm1 C T 15: 81,839,896 (GRCm39) R143H probably damaging Het
Pou1f1 T C 16: 65,328,833 (GRCm39) L186P Het
Ppargc1b G A 18: 61,443,730 (GRCm39) R494W probably damaging Het
Prg4 G T 1: 150,331,288 (GRCm39) P462T unknown Het
Ptcd1 T A 5: 145,091,525 (GRCm39) I525L probably benign Het
Ptchd4 A T 17: 42,813,650 (GRCm39) Y517F probably damaging Het
Pum1 T C 4: 130,480,172 (GRCm39) F693S probably damaging Het
Rad51b T G 12: 79,344,439 (GRCm39) probably benign Het
Rgs12 A T 5: 35,177,753 (GRCm39) probably benign Het
Ribc2 A C 15: 85,022,163 (GRCm39) Q186P probably damaging Het
Sesn2 C A 4: 132,224,195 (GRCm39) probably null Het
Sgf29 G A 7: 126,271,826 (GRCm39) V284M probably damaging Het
Skap2 C T 6: 51,856,750 (GRCm39) probably null Het
Smap1 T A 1: 23,961,154 (GRCm39) E28V probably damaging Het
Smc3 A G 19: 53,617,200 (GRCm39) N538D probably benign Het
Spred3 G A 7: 28,865,955 (GRCm39) R115* probably null Het
Sugt1 T A 14: 79,866,293 (GRCm39) M304K possibly damaging Het
Sval1 T C 6: 41,928,606 (GRCm39) I6T possibly damaging Het
Svil T C 18: 5,097,500 (GRCm39) I1574T probably benign Het
Ticrr T A 7: 79,317,679 (GRCm39) D404E probably benign Het
Tinag T A 9: 76,904,300 (GRCm39) probably null Het
Tpbg A T 9: 85,724,924 (GRCm39) probably null Het
Trak1 T C 9: 121,289,554 (GRCm39) L622P probably damaging Het
Ttn C T 2: 76,586,218 (GRCm39) D21838N probably damaging Het
Vmn1r43 G A 6: 89,846,877 (GRCm39) T203M probably damaging Het
Vmn1r73 C T 7: 11,490,203 (GRCm39) A7V probably benign Het
Yy1 G T 12: 108,759,921 (GRCm39) G195C probably benign Het
Zbtb17 T A 4: 141,193,676 (GRCm39) C607S possibly damaging Het
Zfp735 T C 11: 73,603,060 (GRCm39) V668A probably benign Het
Zfp819 C A 7: 43,266,570 (GRCm39) T351K probably damaging Het
Zfp820 C A 17: 22,039,031 (GRCm39) S99I possibly damaging Het
Other mutations in Spen
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01133:Spen APN 4 141,217,212 (GRCm39) missense unknown
IGL01357:Spen APN 4 141,244,424 (GRCm39) missense unknown
IGL02184:Spen APN 4 141,214,917 (GRCm39) missense unknown
IGL02226:Spen APN 4 141,205,457 (GRCm39) missense unknown
IGL02321:Spen APN 4 141,244,441 (GRCm39) missense unknown
IGL02350:Spen APN 4 141,204,890 (GRCm39) missense unknown
IGL02357:Spen APN 4 141,204,890 (GRCm39) missense unknown
IGL02627:Spen APN 4 141,200,326 (GRCm39) missense probably damaging 0.99
IGL02683:Spen APN 4 141,198,956 (GRCm39) missense probably benign 0.06
IGL02945:Spen APN 4 141,221,624 (GRCm39) missense unknown
IGL02950:Spen APN 4 141,196,819 (GRCm39) missense probably damaging 1.00
IGL03008:Spen APN 4 141,203,448 (GRCm39) missense possibly damaging 0.70
IGL03019:Spen APN 4 141,206,227 (GRCm39) missense unknown
IGL03038:Spen APN 4 141,265,550 (GRCm39) missense unknown
IGL03334:Spen APN 4 141,197,280 (GRCm39) missense probably damaging 1.00
filtered UTSW 4 141,204,683 (GRCm39) missense unknown
mentholated UTSW 4 141,196,711 (GRCm39) missense possibly damaging 0.78
R0105:Spen UTSW 4 141,197,121 (GRCm39) splice site probably benign
R0268:Spen UTSW 4 141,204,868 (GRCm39) missense unknown
R0359:Spen UTSW 4 141,244,181 (GRCm39) missense unknown
R0394:Spen UTSW 4 141,201,514 (GRCm39) missense probably benign 0.03
R0423:Spen UTSW 4 141,206,647 (GRCm39) missense unknown
R0433:Spen UTSW 4 141,211,069 (GRCm39) missense unknown
R0462:Spen UTSW 4 141,200,962 (GRCm39) missense probably damaging 1.00
R0687:Spen UTSW 4 141,215,339 (GRCm39) missense unknown
R0699:Spen UTSW 4 141,201,702 (GRCm39) missense possibly damaging 0.72
R0865:Spen UTSW 4 141,199,181 (GRCm39) missense probably benign 0.11
R0918:Spen UTSW 4 141,212,875 (GRCm39) missense unknown
R1034:Spen UTSW 4 141,203,063 (GRCm39) missense probably benign 0.33
R1341:Spen UTSW 4 141,196,711 (GRCm39) missense possibly damaging 0.78
R1401:Spen UTSW 4 141,199,132 (GRCm39) missense probably damaging 0.98
R1509:Spen UTSW 4 141,202,946 (GRCm39) missense probably benign 0.00
R1509:Spen UTSW 4 141,203,011 (GRCm39) missense possibly damaging 0.53
R1561:Spen UTSW 4 141,199,694 (GRCm39) nonsense probably null
R1589:Spen UTSW 4 141,215,335 (GRCm39) missense unknown
R1640:Spen UTSW 4 141,196,254 (GRCm39) missense probably damaging 0.98
R1758:Spen UTSW 4 141,203,686 (GRCm39) missense unknown
R1764:Spen UTSW 4 141,200,261 (GRCm39) missense probably damaging 1.00
R1824:Spen UTSW 4 141,200,096 (GRCm39) missense probably damaging 1.00
R1899:Spen UTSW 4 141,197,654 (GRCm39) missense probably benign 0.17
R1916:Spen UTSW 4 141,199,909 (GRCm39) missense probably damaging 1.00
R2011:Spen UTSW 4 141,200,640 (GRCm39) missense probably damaging 1.00
R2295:Spen UTSW 4 141,204,584 (GRCm39) missense unknown
R2379:Spen UTSW 4 141,244,238 (GRCm39) missense unknown
R2404:Spen UTSW 4 141,205,216 (GRCm39) missense unknown
R3719:Spen UTSW 4 141,244,494 (GRCm39) missense unknown
R3889:Spen UTSW 4 141,205,192 (GRCm39) missense unknown
R3945:Spen UTSW 4 141,204,664 (GRCm39) missense unknown
R4227:Spen UTSW 4 141,249,458 (GRCm39) missense unknown
R4326:Spen UTSW 4 141,204,683 (GRCm39) missense unknown
R4382:Spen UTSW 4 141,200,450 (GRCm39) missense possibly damaging 0.88
R4542:Spen UTSW 4 141,204,097 (GRCm39) missense unknown
R4757:Spen UTSW 4 141,200,390 (GRCm39) nonsense probably null
R4771:Spen UTSW 4 141,199,907 (GRCm39) missense probably benign 0.14
R5072:Spen UTSW 4 141,249,613 (GRCm39) missense unknown
R5121:Spen UTSW 4 141,203,410 (GRCm39) missense probably benign 0.00
R5176:Spen UTSW 4 141,203,587 (GRCm39) missense unknown
R5290:Spen UTSW 4 141,201,127 (GRCm39) missense probably damaging 1.00
R5291:Spen UTSW 4 141,215,390 (GRCm39) missense unknown
R5293:Spen UTSW 4 141,199,717 (GRCm39) missense possibly damaging 0.89
R5347:Spen UTSW 4 141,198,796 (GRCm39) missense probably benign 0.26
R5511:Spen UTSW 4 141,244,149 (GRCm39) missense unknown
R5511:Spen UTSW 4 141,202,375 (GRCm39) missense possibly damaging 0.86
R5772:Spen UTSW 4 141,205,495 (GRCm39) missense unknown
R5834:Spen UTSW 4 141,199,154 (GRCm39) missense possibly damaging 0.63
R5858:Spen UTSW 4 141,201,182 (GRCm39) missense probably benign 0.05
R6214:Spen UTSW 4 141,206,423 (GRCm39) missense unknown
R6232:Spen UTSW 4 141,244,333 (GRCm39) missense unknown
R6345:Spen UTSW 4 141,198,944 (GRCm39) missense possibly damaging 0.86
R6419:Spen UTSW 4 141,203,621 (GRCm39) missense unknown
R6455:Spen UTSW 4 141,202,820 (GRCm39) missense probably damaging 0.97
R6979:Spen UTSW 4 141,205,374 (GRCm39) missense unknown
R6994:Spen UTSW 4 141,220,770 (GRCm39) missense unknown
R7018:Spen UTSW 4 141,220,755 (GRCm39) missense unknown
R7040:Spen UTSW 4 141,221,693 (GRCm39) missense unknown
R7127:Spen UTSW 4 141,203,419 (GRCm39) missense possibly damaging 0.53
R7218:Spen UTSW 4 141,199,961 (GRCm39) missense possibly damaging 0.54
R7234:Spen UTSW 4 141,206,446 (GRCm39) missense unknown
R7316:Spen UTSW 4 141,204,365 (GRCm39) missense unknown
R7350:Spen UTSW 4 141,206,696 (GRCm39) missense unknown
R7356:Spen UTSW 4 141,199,235 (GRCm39) nonsense probably null
R7400:Spen UTSW 4 141,201,052 (GRCm39) missense probably damaging 1.00
R7470:Spen UTSW 4 141,206,605 (GRCm39) missense unknown
R7698:Spen UTSW 4 141,200,156 (GRCm39) missense probably damaging 1.00
R7858:Spen UTSW 4 141,215,442 (GRCm39) splice site probably null
R8033:Spen UTSW 4 141,199,057 (GRCm39) missense probably benign 0.03
R8064:Spen UTSW 4 141,203,011 (GRCm39) missense possibly damaging 0.53
R8159:Spen UTSW 4 141,202,314 (GRCm39) missense possibly damaging 0.53
R8187:Spen UTSW 4 141,200,216 (GRCm39) missense possibly damaging 0.93
R8463:Spen UTSW 4 141,249,590 (GRCm39) missense unknown
R8557:Spen UTSW 4 141,197,681 (GRCm39) missense probably benign 0.14
R8558:Spen UTSW 4 141,197,681 (GRCm39) missense probably benign 0.14
R8672:Spen UTSW 4 141,197,681 (GRCm39) missense probably benign 0.14
R8673:Spen UTSW 4 141,197,681 (GRCm39) missense probably benign 0.14
R8674:Spen UTSW 4 141,197,681 (GRCm39) missense probably benign 0.14
R8714:Spen UTSW 4 141,215,314 (GRCm39) missense unknown
R8735:Spen UTSW 4 141,197,129 (GRCm39) missense probably benign 0.32
R8762:Spen UTSW 4 141,200,261 (GRCm39) missense probably damaging 1.00
R8877:Spen UTSW 4 141,199,137 (GRCm39) nonsense probably null
R8878:Spen UTSW 4 141,204,520 (GRCm39) missense unknown
R8937:Spen UTSW 4 141,201,374 (GRCm39) missense probably damaging 1.00
R8939:Spen UTSW 4 141,202,969 (GRCm39) missense possibly damaging 0.72
R8968:Spen UTSW 4 141,197,701 (GRCm39) missense probably benign 0.02
R8971:Spen UTSW 4 141,201,889 (GRCm39) missense possibly damaging 0.53
R9016:Spen UTSW 4 141,200,938 (GRCm39) missense probably damaging 1.00
R9072:Spen UTSW 4 141,203,702 (GRCm39) missense unknown
R9120:Spen UTSW 4 141,200,233 (GRCm39) missense
R9136:Spen UTSW 4 141,249,623 (GRCm39) missense unknown
R9138:Spen UTSW 4 141,196,797 (GRCm39) missense probably damaging 1.00
R9150:Spen UTSW 4 141,244,468 (GRCm39) missense unknown
R9225:Spen UTSW 4 141,202,943 (GRCm39) missense possibly damaging 0.53
R9492:Spen UTSW 4 141,199,098 (GRCm39) missense probably benign 0.26
R9537:Spen UTSW 4 141,244,156 (GRCm39) small deletion probably benign
R9537:Spen UTSW 4 141,199,015 (GRCm39) missense probably benign 0.15
R9602:Spen UTSW 4 141,205,183 (GRCm39) missense unknown
R9609:Spen UTSW 4 141,215,419 (GRCm39) missense unknown
R9686:Spen UTSW 4 141,199,946 (GRCm39) missense probably benign 0.27
R9697:Spen UTSW 4 141,196,275 (GRCm39) missense probably damaging 1.00
R9713:Spen UTSW 4 141,244,331 (GRCm39) missense unknown
T0722:Spen UTSW 4 141,201,664 (GRCm39) missense probably benign 0.33
T0975:Spen UTSW 4 141,201,664 (GRCm39) missense probably benign 0.33
Z1088:Spen UTSW 4 141,205,287 (GRCm39) missense unknown
Z1088:Spen UTSW 4 141,205,288 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- CAAGCTTTGTTTCTTCCGAGACAG -3'
(R):5'- TGCAGCACCTTGAGAGGAAG -3'

Sequencing Primer
(F):5'- TTTCTTCCGAGACAGGAGCG -3'
(R):5'- CGTCTGAGGGTGCAAACAGC -3'
Posted On 2021-12-30