Incidental Mutation 'R9073:Hydin'
ID 692884
Institutional Source Beutler Lab
Gene Symbol Hydin
Ensembl Gene ENSMUSG00000059854
Gene Name HYDIN, axonemal central pair apparatus protein
Synonyms hy-3, hyrh, hy3, 1700034M11Rik, 4930545D19Rik
Accession Numbers

Ncbi RefSeq: NM_172916; MGI: 2389007

Is this an essential gene? Possibly essential (E-score: 0.718) question?
Stock # R9073 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 110266977-110610253 bp(+) (GRCm38)
Type of Mutation critical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to A at 110267451 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000046204 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043141]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000043141
SMART Domains Protein: ENSMUSP00000046204
Gene: ENSMUSG00000059854

DomainStartEndE-ValueType
Pfam:Motile_Sperm 246 325 5.6e-8 PFAM
Pfam:ASH 559 659 9.4e-17 PFAM
low complexity region 788 798 N/A INTRINSIC
Pfam:PapD-like 848 906 1.2e-6 PFAM
low complexity region 998 1024 N/A INTRINSIC
low complexity region 1279 1292 N/A INTRINSIC
internal_repeat_6 1317 1549 5.96e-5 PROSPERO
internal_repeat_5 1355 1502 3.23e-5 PROSPERO
low complexity region 1574 1590 N/A INTRINSIC
internal_repeat_4 1712 1940 5.14e-6 PROSPERO
coiled coil region 1947 1977 N/A INTRINSIC
low complexity region 2009 2020 N/A INTRINSIC
low complexity region 2034 2049 N/A INTRINSIC
SCOP:d1eq1a_ 2305 2403 3e-4 SMART
low complexity region 2404 2419 N/A INTRINSIC
coiled coil region 2543 2588 N/A INTRINSIC
low complexity region 2636 2656 N/A INTRINSIC
internal_repeat_7 2772 3008 8.1e-5 PROSPERO
low complexity region 3660 3670 N/A INTRINSIC
low complexity region 3919 3934 N/A INTRINSIC
internal_repeat_5 4046 4190 3.23e-5 PROSPERO
internal_repeat_2 4106 4251 6.03e-7 PROSPERO
internal_repeat_4 4317 4532 5.14e-6 PROSPERO
internal_repeat_3 4403 4689 2.05e-6 PROSPERO
internal_repeat_2 4549 4697 6.03e-7 PROSPERO
low complexity region 4951 4964 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 99% (79/80)
MGI Phenotype Strain: 1856913; 3801608
Lethality: D28-D42
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that may be involved in cilia motility. Mutations in this gene cause of autosomal recessive primary ciliary dyskinesia-5, a disorder characterized by the accumulation of cerebrospinal fluid within the ventricles of the brain. A duplicate copy of this gene has been found in humans on chromosome 1. [provided by RefSeq, Jan 2013]
PHENOTYPE: Mice homozygous for a mutation in this gene develop hydrocephaly after birth. Symptoms develop after 3-5 days. Affected animals usually die before 2 months of age. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Targeted(1) Gene trapped(3) Transgenic(1) Spontaneous(2)

Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aak1 T A 6: 86,944,392 Y190* probably null Het
Agbl3 T C 6: 34,799,452 C298R probably damaging Het
Ankrd26 T A 6: 118,523,389 K1040N probably damaging Het
Ano3 T A 2: 110,745,898 T93S probably benign Het
Apoc3 T A 9: 46,233,234 I97F probably benign Het
Arid5a A G 1: 36,319,545 E401G probably benign Het
Atxn3 T C 12: 101,937,471 probably null Het
Brca1 C T 11: 101,502,480 probably null Het
C1ql3 T A 2: 13,010,387 N154I probably damaging Het
Calcoco2 GGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC GGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC 11: 96,099,982 probably benign Het
Ccdc110 A T 8: 45,942,838 M589L probably benign Het
Ccnb2 A T 9: 70,410,813 F226I possibly damaging Het
Clasp1 C A 1: 118,462,463 probably null Het
Commd8 TTGTCATCT TT 5: 72,160,984 probably null Het
Dis3 T C 14: 99,095,211 T262A probably benign Het
Eif4a2 G A 16: 23,110,653 R234Q probably benign Het
Ephx2 G A 14: 66,086,239 R481* probably null Het
Fbxo15 T C 18: 84,965,520 I331T possibly damaging Het
Gfra2 A G 14: 70,901,495 E121G possibly damaging Het
Git1 G A 11: 77,499,075 A55T probably benign Het
Gm12887 G T 4: 121,622,041 probably null Het
Hfm1 T C 5: 106,898,280 I553V probably benign Het
Iqgap3 A G 3: 88,109,466 N1085S Het
Kbtbd12 T C 6: 88,618,440 Y136C probably damaging Het
Kcng3 A G 17: 83,630,994 Y209H possibly damaging Het
Kcnj2 A T 11: 111,071,838 M19L possibly damaging Het
Lonrf2 A T 1: 38,811,786 F232I probably damaging Het
Lrrc31 T C 3: 30,699,710 D14G probably benign Het
Ly6l G A 15: 75,449,736 V62I possibly damaging Het
March8 T C 6: 116,401,923 F273L probably benign Het
Masp1 A C 16: 23,469,921 S710A probably benign Het
Mcm10 G A 2: 5,008,603 R73C possibly damaging Het
Mcm5 G A 8: 75,126,306 R682H probably damaging Het
Mink1 C T 11: 70,608,381 T684I possibly damaging Het
Mocos A T 18: 24,664,032 Q83L probably damaging Het
Nags T C 11: 102,147,521 L351P probably damaging Het
Nalcn G A 14: 123,295,451 T1299I possibly damaging Het
Nlrp4b A G 7: 10,725,943 D824G probably benign Het
Nwd1 A T 8: 72,695,418 M1031L probably benign Het
Olfr1164 T A 2: 88,093,828 Q36L probably benign Het
Olfr1188 A C 2: 88,560,314 I271L probably benign Het
Olfr1286 A T 2: 111,420,360 I197N possibly damaging Het
Olfr1466 A G 19: 13,341,874 T39A possibly damaging Het
Olfr657 C T 7: 104,636,084 R137C probably benign Het
Olfr743 C T 14: 50,533,754 T114I probably benign Het
Pan2 T C 10: 128,315,181 M807T probably damaging Het
Parp8 A T 13: 116,911,415 I222N probably damaging Het
Pmm1 C T 15: 81,955,695 R143H probably damaging Het
Pou1f1 T C 16: 65,531,947 L186P Het
Ppargc1b G A 18: 61,310,659 R494W probably damaging Het
Prg4 G T 1: 150,455,537 P462T unknown Het
Ptcd1 T A 5: 145,154,715 I525L probably benign Het
Ptchd4 A T 17: 42,502,759 Y517F probably damaging Het
Pum1 T C 4: 130,752,861 F693S probably damaging Het
Rad51b T G 12: 79,297,665 probably benign Het
Rgs12 A T 5: 35,020,409 probably benign Het
Ribc2 A C 15: 85,137,962 Q186P probably damaging Het
Sesn2 C A 4: 132,496,884 probably null Het
Sgf29 G A 7: 126,672,654 V284M probably damaging Het
Skap2 C T 6: 51,879,770 probably null Het
Smap1 T A 1: 23,922,073 E28V probably damaging Het
Smc3 A G 19: 53,628,769 N538D probably benign Het
Spen T C 4: 141,476,391 T1642A unknown Het
Spred3 G A 7: 29,166,530 R115* probably null Het
Sugt1 T A 14: 79,628,853 M304K possibly damaging Het
Sval1 T C 6: 41,951,672 I6T possibly damaging Het
Svil T C 18: 5,097,500 I1574T probably benign Het
Ticrr T A 7: 79,667,931 D404E probably benign Het
Tinag T A 9: 76,997,018 probably null Het
Tpbg A T 9: 85,842,871 probably null Het
Trak1 T C 9: 121,460,488 L622P probably damaging Het
Ttn C T 2: 76,755,874 D21838N probably damaging Het
Vmn1r43 G A 6: 89,869,895 T203M probably damaging Het
Vmn1r73 C T 7: 11,756,276 A7V probably benign Het
Yy1 G T 12: 108,793,995 G195C probably benign Het
Zbtb17 T A 4: 141,466,365 C607S possibly damaging Het
Zfp735 T C 11: 73,712,234 V668A probably benign Het
Zfp819 C A 7: 43,617,146 T351K probably damaging Het
Zfp820 C A 17: 21,820,050 S99I possibly damaging Het
Other mutations in Hydin
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00338:Hydin APN 8 110569802 missense possibly damaging 0.69
IGL00432:Hydin APN 8 110601252 missense probably damaging 0.98
IGL01025:Hydin APN 8 110326401 missense probably benign 0.38
IGL01140:Hydin APN 8 110398062 missense probably benign 0.14
IGL01317:Hydin APN 8 110326446 missense probably damaging 0.98
IGL01473:Hydin APN 8 110312160 missense probably benign 0.08
IGL01473:Hydin APN 8 110354953 missense probably damaging 1.00
IGL01610:Hydin APN 8 110557713 missense probably benign 0.00
IGL01685:Hydin APN 8 110355033 nonsense probably null
IGL01734:Hydin APN 8 110490789 nonsense probably null
IGL01743:Hydin APN 8 110592776 missense possibly damaging 0.94
IGL01829:Hydin APN 8 110589522 missense possibly damaging 0.68
IGL01919:Hydin APN 8 110519174 missense possibly damaging 0.89
IGL01946:Hydin APN 8 110490718 missense possibly damaging 0.91
IGL01983:Hydin APN 8 110514895 missense probably benign 0.02
IGL02122:Hydin APN 8 110494415 missense possibly damaging 0.86
IGL02140:Hydin APN 8 110566938 missense probably benign
IGL02158:Hydin APN 8 110609966 missense possibly damaging 0.89
IGL02167:Hydin APN 8 110418423 missense possibly damaging 0.96
IGL02171:Hydin APN 8 110451958 nonsense probably null
IGL02185:Hydin APN 8 110506476 missense possibly damaging 0.86
IGL02517:Hydin APN 8 110566972 missense probably benign 0.01
IGL02639:Hydin APN 8 110538449 missense probably benign 0.01
IGL02644:Hydin APN 8 110538468 missense probably damaging 1.00
IGL02652:Hydin APN 8 110589522 missense possibly damaging 0.68
IGL02658:Hydin APN 8 110413276 missense possibly damaging 0.86
IGL02706:Hydin APN 8 110410566 missense probably damaging 0.99
IGL02892:Hydin APN 8 110598959 missense possibly damaging 0.89
IGL02947:Hydin APN 8 110418462 missense probably damaging 0.96
IGL03136:Hydin APN 8 110418524 missense probably benign 0.22
IGL03248:Hydin APN 8 110595289 missense probably damaging 0.97
IGL03251:Hydin APN 8 110490596 missense probably damaging 1.00
IGL03350:Hydin APN 8 110312224 missense possibly damaging 0.86
IGL03366:Hydin APN 8 110267363 missense unknown
IGL03404:Hydin APN 8 110569777 missense probably benign 0.06
Franz_joseph UTSW 8 110601318 missense probably damaging 1.00
jahreszeiten UTSW 8 110569359 missense probably damaging 1.00
maria UTSW 8 110509127 splice site probably benign
schoepfung UTSW 8 110600245 missense possibly damaging 0.68
surprise UTSW 8 110528016 missense probably benign
teresa UTSW 8 110609671 missense possibly damaging 0.79
BB001:Hydin UTSW 8 110418471 missense possibly damaging 0.93
BB004:Hydin UTSW 8 110580844 missense possibly damaging 0.89
BB011:Hydin UTSW 8 110418471 missense possibly damaging 0.93
BB014:Hydin UTSW 8 110580844 missense possibly damaging 0.89
P0005:Hydin UTSW 8 110494289 critical splice acceptor site probably null
R0099:Hydin UTSW 8 110589561 missense probably damaging 1.00
R0125:Hydin UTSW 8 110462531 missense probably benign 0.12
R0157:Hydin UTSW 8 110300010 missense possibly damaging 0.86
R0241:Hydin UTSW 8 110398023 missense probably benign 0.04
R0241:Hydin UTSW 8 110398023 missense probably benign 0.04
R0255:Hydin UTSW 8 110565018 missense probably benign 0.00
R0352:Hydin UTSW 8 110569901 critical splice donor site probably null
R0379:Hydin UTSW 8 110509127 splice site probably benign
R0468:Hydin UTSW 8 110413223 missense possibly damaging 0.96
R0477:Hydin UTSW 8 110418498 missense probably damaging 1.00
R0479:Hydin UTSW 8 110599088 missense probably damaging 1.00
R0539:Hydin UTSW 8 110523072 missense probably benign
R0550:Hydin UTSW 8 110587775 missense probably benign 0.01
R0571:Hydin UTSW 8 110514103 splice site probably null
R0606:Hydin UTSW 8 110549798 splice site probably benign
R0789:Hydin UTSW 8 110566971 missense possibly damaging 0.53
R0849:Hydin UTSW 8 110598984 missense probably damaging 1.00
R0946:Hydin UTSW 8 110531053 missense probably benign 0.25
R1201:Hydin UTSW 8 110569855 missense probably benign 0.01
R1375:Hydin UTSW 8 110506222 critical splice donor site probably null
R1385:Hydin UTSW 8 110523204 missense probably benign 0.40
R1411:Hydin UTSW 8 110575031 missense probably benign 0.04
R1437:Hydin UTSW 8 110581985 nonsense probably null
R1447:Hydin UTSW 8 110523166 missense probably damaging 1.00
R1448:Hydin UTSW 8 110446585 missense probably benign 0.27
R1466:Hydin UTSW 8 110532953 missense possibly damaging 0.47
R1466:Hydin UTSW 8 110532953 missense possibly damaging 0.47
R1523:Hydin UTSW 8 110533271 missense probably benign 0.05
R1544:Hydin UTSW 8 110574854 missense probably benign 0.30
R1581:Hydin UTSW 8 110410460 missense probably benign
R1584:Hydin UTSW 8 110580815 missense probably benign 0.27
R1598:Hydin UTSW 8 110410674 missense possibly damaging 0.96
R1633:Hydin UTSW 8 110506982 missense probably benign 0.10
R1777:Hydin UTSW 8 110589571 missense probably benign 0.14
R1817:Hydin UTSW 8 110532827 missense probably benign 0.00
R1828:Hydin UTSW 8 110510894 missense probably benign 0.03
R1837:Hydin UTSW 8 110569625 missense probably benign 0.20
R1848:Hydin UTSW 8 110569808 missense probably benign 0.19
R1869:Hydin UTSW 8 110500705 missense possibly damaging 0.94
R1909:Hydin UTSW 8 110587772 missense probably damaging 1.00
R1928:Hydin UTSW 8 110502947 missense possibly damaging 0.93
R1950:Hydin UTSW 8 110609987 missense possibly damaging 0.64
R2095:Hydin UTSW 8 110462657 missense probably damaging 0.96
R2172:Hydin UTSW 8 110582049 missense probably benign 0.42
R2217:Hydin UTSW 8 110418506 missense probably benign
R2248:Hydin UTSW 8 110578203 missense probably benign 0.09
R2272:Hydin UTSW 8 110309132 missense probably benign 0.01
R2294:Hydin UTSW 8 110299959 missense probably damaging 0.99
R2315:Hydin UTSW 8 110398044 missense probably benign 0.01
R2330:Hydin UTSW 8 110565009 missense probably benign 0.01
R2374:Hydin UTSW 8 110565148 missense probably damaging 1.00
R2446:Hydin UTSW 8 110587715 missense possibly damaging 0.82
R2484:Hydin UTSW 8 110513115 missense possibly damaging 0.76
R2698:Hydin UTSW 8 110609929 missense possibly damaging 0.70
R2843:Hydin UTSW 8 110519114 missense probably benign
R2844:Hydin UTSW 8 110519114 missense probably benign
R2846:Hydin UTSW 8 110519114 missense probably benign
R2882:Hydin UTSW 8 110566923 missense possibly damaging 0.92
R2937:Hydin UTSW 8 110404295 missense possibly damaging 0.88
R3031:Hydin UTSW 8 110603216 missense possibly damaging 0.83
R3038:Hydin UTSW 8 110582689 missense probably damaging 1.00
R3121:Hydin UTSW 8 110506506 missense probably benign
R3157:Hydin UTSW 8 110267373 missense unknown
R3547:Hydin UTSW 8 110582067 missense possibly damaging 0.85
R3696:Hydin UTSW 8 110603279 missense probably damaging 1.00
R3850:Hydin UTSW 8 110563929 missense probably damaging 0.99
R3896:Hydin UTSW 8 110509079 missense possibly damaging 0.93
R3983:Hydin UTSW 8 110392325 missense probably damaging 1.00
R4031:Hydin UTSW 8 110610047 missense probably benign 0.30
R4072:Hydin UTSW 8 110505256 missense possibly damaging 0.68
R4095:Hydin UTSW 8 110541547 missense probably damaging 0.98
R4176:Hydin UTSW 8 110593820 missense probably benign 0.00
R4213:Hydin UTSW 8 110456507 missense possibly damaging 0.91
R4412:Hydin UTSW 8 110415736 missense probably damaging 0.99
R4471:Hydin UTSW 8 110587132 missense probably damaging 1.00
R4474:Hydin UTSW 8 110563865 missense probably benign 0.11
R4495:Hydin UTSW 8 110595402 missense probably damaging 0.99
R4508:Hydin UTSW 8 110519254 missense possibly damaging 0.91
R4578:Hydin UTSW 8 110267339 missense unknown
R4583:Hydin UTSW 8 110595225 missense probably benign 0.36
R4600:Hydin UTSW 8 110566950 missense probably benign 0.04
R4681:Hydin UTSW 8 110506471 missense possibly damaging 0.85
R4685:Hydin UTSW 8 110462522 missense probably damaging 0.99
R4689:Hydin UTSW 8 110595414 missense probably benign 0.18
R4735:Hydin UTSW 8 110555632 critical splice donor site probably null
R4736:Hydin UTSW 8 110523208 missense probably benign 0.02
R4740:Hydin UTSW 8 110446439 missense probably benign 0.06
R4771:Hydin UTSW 8 110532883 missense probably benign
R4777:Hydin UTSW 8 110410464 missense probably damaging 0.98
R4859:Hydin UTSW 8 110506494 missense possibly damaging 0.93
R4911:Hydin UTSW 8 110595438 missense probably benign 0.01
R4964:Hydin UTSW 8 110490673 missense possibly damaging 0.86
R4965:Hydin UTSW 8 110398095 missense probably benign
R4989:Hydin UTSW 8 110563922 missense possibly damaging 0.84
R4995:Hydin UTSW 8 110569642 missense probably damaging 0.97
R5059:Hydin UTSW 8 110505769 missense probably damaging 0.96
R5071:Hydin UTSW 8 110538473 missense probably benign 0.03
R5073:Hydin UTSW 8 110538473 missense probably benign 0.03
R5092:Hydin UTSW 8 110582668 missense probably benign 0.16
R5156:Hydin UTSW 8 110609701 missense probably benign 0.00
R5166:Hydin UTSW 8 110523142 missense possibly damaging 0.89
R5189:Hydin UTSW 8 110413211 critical splice acceptor site probably null
R5243:Hydin UTSW 8 110505748 missense possibly damaging 0.92
R5244:Hydin UTSW 8 110532819 missense possibly damaging 0.77
R5256:Hydin UTSW 8 110587223 missense possibly damaging 0.92
R5266:Hydin UTSW 8 110334784 missense possibly damaging 0.87
R5283:Hydin UTSW 8 110451980 missense possibly damaging 0.96
R5343:Hydin UTSW 8 110485419 missense probably benign 0.40
R5359:Hydin UTSW 8 110538372 missense probably benign 0.00
R5390:Hydin UTSW 8 110595467 missense probably benign
R5394:Hydin UTSW 8 110539842 splice site probably null
R5441:Hydin UTSW 8 110565109 missense possibly damaging 0.72
R5461:Hydin UTSW 8 110519231 missense probably damaging 0.96
R5662:Hydin UTSW 8 110580709 missense probably benign 0.02
R5695:Hydin UTSW 8 110535283 missense probably benign 0.35
R5732:Hydin UTSW 8 110452058 missense probably benign 0.03
R5774:Hydin UTSW 8 110571915 nonsense probably null
R5780:Hydin UTSW 8 110586080 missense probably damaging 1.00
R5787:Hydin UTSW 8 110326353 missense probably damaging 0.99
R5802:Hydin UTSW 8 110452060 missense possibly damaging 0.86
R5841:Hydin UTSW 8 110533214 missense possibly damaging 0.76
R5856:Hydin UTSW 8 110541842 missense probably damaging 0.99
R5893:Hydin UTSW 8 110490676 missense probably benign 0.12
R5963:Hydin UTSW 8 110494294 missense possibly damaging 0.93
R6008:Hydin UTSW 8 110599085 missense probably benign 0.02
R6019:Hydin UTSW 8 110566620 missense probably benign
R6038:Hydin UTSW 8 110599031 missense probably benign 0.16
R6038:Hydin UTSW 8 110599031 missense probably benign 0.16
R6133:Hydin UTSW 8 110601276 missense probably benign 0.00
R6135:Hydin UTSW 8 110462660 missense possibly damaging 0.85
R6157:Hydin UTSW 8 110528016 missense probably benign
R6209:Hydin UTSW 8 110593802 missense probably benign 0.05
R6238:Hydin UTSW 8 110392111 splice site probably null
R6293:Hydin UTSW 8 110597911 missense possibly damaging 0.83
R6340:Hydin UTSW 8 110354942 splice site probably null
R6349:Hydin UTSW 8 110418459 nonsense probably null
R6357:Hydin UTSW 8 110541657 missense possibly damaging 0.86
R6385:Hydin UTSW 8 110312224 missense possibly damaging 0.86
R6396:Hydin UTSW 8 110506889 missense probably damaging 0.96
R6466:Hydin UTSW 8 110506968 missense possibly damaging 0.85
R6648:Hydin UTSW 8 110525667 splice site probably null
R6671:Hydin UTSW 8 110601318 missense probably damaging 1.00
R6695:Hydin UTSW 8 110326460 missense probably benign 0.05
R6800:Hydin UTSW 8 110597971 missense probably benign 0.09
R6841:Hydin UTSW 8 110538375 missense probably benign 0.09
R6867:Hydin UTSW 8 110539802 missense probably benign 0.08
R6889:Hydin UTSW 8 110532856 missense possibly damaging 0.79
R6895:Hydin UTSW 8 110312251 missense probably benign 0.00
R6940:Hydin UTSW 8 110490611 missense probably damaging 1.00
R6951:Hydin UTSW 8 110398125 missense probably benign
R6980:Hydin UTSW 8 110413284 missense possibly damaging 0.91
R6981:Hydin UTSW 8 110531072 missense possibly damaging 0.89
R7061:Hydin UTSW 8 110603288 missense possibly damaging 0.90
R7085:Hydin UTSW 8 110603330 missense probably benign 0.03
R7086:Hydin UTSW 8 110600245 missense possibly damaging 0.68
R7110:Hydin UTSW 8 110354951 critical splice acceptor site probably null
R7158:Hydin UTSW 8 110609671 missense possibly damaging 0.79
R7163:Hydin UTSW 8 110603336 missense probably benign 0.25
R7209:Hydin UTSW 8 110489792 nonsense probably null
R7244:Hydin UTSW 8 110549675 missense probably damaging 0.98
R7347:Hydin UTSW 8 110600362 missense probably benign 0.06
R7349:Hydin UTSW 8 110398171 splice site probably null
R7359:Hydin UTSW 8 110506101 missense probably damaging 0.98
R7365:Hydin UTSW 8 110557662 missense probably damaging 0.99
R7365:Hydin UTSW 8 110601273 missense probably damaging 1.00
R7436:Hydin UTSW 8 110583914 missense probably damaging 0.96
R7528:Hydin UTSW 8 110380572 nonsense probably null
R7544:Hydin UTSW 8 110589525 missense probably benign 0.35
R7625:Hydin UTSW 8 110541844 missense probably benign 0.01
R7713:Hydin UTSW 8 110593812 missense possibly damaging 0.69
R7763:Hydin UTSW 8 110505843 missense possibly damaging 0.92
R7771:Hydin UTSW 8 110565085 missense probably damaging 0.97
R7794:Hydin UTSW 8 110509083 missense probably damaging 1.00
R7833:Hydin UTSW 8 110589460 missense probably damaging 0.99
R7894:Hydin UTSW 8 110513010 missense possibly damaging 0.88
R7899:Hydin UTSW 8 110587748 missense probably benign 0.00
R7908:Hydin UTSW 8 110510867 missense probably benign 0.01
R7912:Hydin UTSW 8 110555607 missense possibly damaging 0.68
R7919:Hydin UTSW 8 110267339 missense unknown
R7924:Hydin UTSW 8 110418471 missense possibly damaging 0.93
R7927:Hydin UTSW 8 110580844 missense possibly damaging 0.89
R7970:Hydin UTSW 8 110309091 missense probably damaging 0.99
R7993:Hydin UTSW 8 110579632 missense probably benign
R8011:Hydin UTSW 8 110583909 missense probably damaging 1.00
R8041:Hydin UTSW 8 110574994 missense probably benign 0.02
R8080:Hydin UTSW 8 110535231 missense probably benign 0.32
R8081:Hydin UTSW 8 110365469 missense possibly damaging 0.93
R8095:Hydin UTSW 8 110569359 missense probably damaging 1.00
R8157:Hydin UTSW 8 110452036 missense probably benign 0.33
R8186:Hydin UTSW 8 110609645 missense probably benign 0.14
R8205:Hydin UTSW 8 110592638 missense possibly damaging 0.57
R8263:Hydin UTSW 8 110452073 missense probably benign 0.00
R8288:Hydin UTSW 8 110507029 missense probably damaging 0.96
R8298:Hydin UTSW 8 110600383 missense probably damaging 1.00
R8309:Hydin UTSW 8 110607902 missense probably benign 0.18
R8348:Hydin UTSW 8 110603246 missense possibly damaging 0.68
R8356:Hydin UTSW 8 110533124 missense possibly damaging 0.67
R8406:Hydin UTSW 8 110609911 missense possibly damaging 0.94
R8415:Hydin UTSW 8 110451994 missense probably damaging 1.00
R8417:Hydin UTSW 8 110569392 missense probably benign 0.28
R8432:Hydin UTSW 8 110597951 missense probably benign 0.02
R8437:Hydin UTSW 8 110462735 missense probably damaging 0.96
R8463:Hydin UTSW 8 110510921 missense probably benign 0.22
R8508:Hydin UTSW 8 110582018 missense probably benign 0.00
R8510:Hydin UTSW 8 110506570 missense probably damaging 1.00
R8560:Hydin UTSW 8 110538474 missense probably benign 0.09
R8682:Hydin UTSW 8 110309166 missense probably damaging 0.96
R8697:Hydin UTSW 8 110532883 missense probably benign
R8857:Hydin UTSW 8 110571955 critical splice donor site probably null
R8866:Hydin UTSW 8 110582147 missense possibly damaging 0.89
R8878:Hydin UTSW 8 110309088 missense probably benign 0.12
R8897:Hydin UTSW 8 110589480 missense probably benign
R8987:Hydin UTSW 8 110513134 nonsense probably null
R9072:Hydin UTSW 8 110267451 critical splice donor site probably null
R9102:Hydin UTSW 8 110508914 missense probably benign 0.33
R9224:Hydin UTSW 8 110532884 missense probably benign
R9255:Hydin UTSW 8 110535340 missense probably benign 0.23
R9257:Hydin UTSW 8 110575016 missense probably damaging 0.99
R9261:Hydin UTSW 8 110267415 missense unknown
R9273:Hydin UTSW 8 110506948 missense probably damaging 0.98
R9376:Hydin UTSW 8 110398063 missense possibly damaging 0.70
R9380:Hydin UTSW 8 110563872 missense probably benign 0.07
R9386:Hydin UTSW 8 110587730 missense probably benign
R9406:Hydin UTSW 8 110587780 missense probably null 0.96
R9492:Hydin UTSW 8 110600245 missense possibly damaging 0.68
R9513:Hydin UTSW 8 110595482 missense probably damaging 0.99
R9562:Hydin UTSW 8 110586154 missense probably benign 0.11
X0063:Hydin UTSW 8 110551319 missense probably damaging 1.00
Z1088:Hydin UTSW 8 110299973 missense probably benign 0.12
Z1088:Hydin UTSW 8 110586048 missense probably benign 0.00
Z1088:Hydin UTSW 8 110592791 frame shift probably null
Z1176:Hydin UTSW 8 110541600 missense possibly damaging 0.65
Z1177:Hydin UTSW 8 110380610 missense probably damaging 1.00
Z1177:Hydin UTSW 8 110450232 missense possibly damaging 0.47
Z1177:Hydin UTSW 8 110587142 frame shift probably null
Z1177:Hydin UTSW 8 110609989 missense probably benign 0.10
Z1188:Hydin UTSW 8 110415787 missense probably benign 0.40
Predicted Primers PCR Primer
(F):5'- TCAGCTTTGGGCAAATCGC -3'
(R):5'- CAATCGTCTAATTAACACTCGGGC -3'

Sequencing Primer
(F):5'- TCTTCCCTAGGAAAATGGATGGC -3'
(R):5'- AATTAACACTCGGGCGCTTG -3'
Posted On 2021-12-30