Incidental Mutation 'R9073:Masp1'
ID 692910
Institutional Source Beutler Lab
Gene Symbol Masp1
Ensembl Gene ENSMUSG00000022887
Gene Name mannan-binding lectin serine peptidase 1
Synonyms Crarf
Accession Numbers

Genbank: NM_008555; MGI: 88492

Is this an essential gene? Probably non essential (E-score: 0.166) question?
Stock # R9073 (G1)
Quality Score 225.009
Status Not validated
Chromosome 16
Chromosomal Location 23449417-23520815 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to C at 23469921 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Alanine at position 710 (S710A)
Ref Sequence ENSEMBL: ENSMUSP00000155665 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089883] [ENSMUST00000229619]
AlphaFold P98064
Predicted Effect probably benign
Transcript: ENSMUST00000089883
SMART Domains Protein: ENSMUSP00000087327
Gene: ENSMUSG00000022887

DomainStartEndE-ValueType
low complexity region 9 19 N/A INTRINSIC
CUB 23 143 2.96e-36 SMART
EGF_CA 144 187 1.46e-7 SMART
CUB 190 302 1.49e-41 SMART
CCP 306 367 4.41e-12 SMART
CCP 372 437 3.05e-6 SMART
Tryp_SPc 453 696 4.66e-84 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000229619
AA Change: S710A

PolyPhen 2 Score 0.067 (Sensitivity: 0.94; Specificity: 0.84)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knockout allele display decreased survivor rate, reduced body weight, and impaired activation of the lectin and alternative complement pathways. [provided by MGI curators]
Allele List at MGI

All alleles(2) : Targeted, knock-out(1) Gene trapped(1)

Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aak1 T A 6: 86,944,392 Y190* probably null Het
Agbl3 T C 6: 34,799,452 C298R probably damaging Het
Ankrd26 T A 6: 118,523,389 K1040N probably damaging Het
Ano3 T A 2: 110,745,898 T93S probably benign Het
Apoc3 T A 9: 46,233,234 I97F probably benign Het
Arid5a A G 1: 36,319,545 E401G probably benign Het
Atxn3 T C 12: 101,937,471 probably null Het
Brca1 C T 11: 101,502,480 probably null Het
C1ql3 T A 2: 13,010,387 N154I probably damaging Het
Calcoco2 GGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC GGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC 11: 96,099,982 probably benign Het
Ccdc110 A T 8: 45,942,838 M589L probably benign Het
Ccnb2 A T 9: 70,410,813 F226I possibly damaging Het
Commd8 TTGTCATCT TT 5: 72,160,984 probably null Het
Dis3 T C 14: 99,095,211 T262A probably benign Het
Eif4a2 G A 16: 23,110,653 R234Q probably benign Het
Ephx2 G A 14: 66,086,239 R481* probably null Het
Fbxo15 T C 18: 84,965,520 I331T possibly damaging Het
Gfra2 A G 14: 70,901,495 E121G possibly damaging Het
Git1 G A 11: 77,499,075 A55T probably benign Het
Hfm1 T C 5: 106,898,280 I553V probably benign Het
Hydin G A 8: 110,267,451 probably null Het
Iqgap3 A G 3: 88,109,466 N1085S Het
Kbtbd12 T C 6: 88,618,440 Y136C probably damaging Het
Kcng3 A G 17: 83,630,994 Y209H possibly damaging Het
Kcnj2 A T 11: 111,071,838 M19L possibly damaging Het
Lonrf2 A T 1: 38,811,786 F232I probably damaging Het
Lrrc31 T C 3: 30,699,710 D14G probably benign Het
Ly6l G A 15: 75,449,736 V62I possibly damaging Het
March8 T C 6: 116,401,923 F273L probably benign Het
Mcm10 G A 2: 5,008,603 R73C possibly damaging Het
Mcm5 G A 8: 75,126,306 R682H probably damaging Het
Mink1 C T 11: 70,608,381 T684I possibly damaging Het
Mocos A T 18: 24,664,032 Q83L probably damaging Het
Nags T C 11: 102,147,521 L351P probably damaging Het
Nalcn G A 14: 123,295,451 T1299I possibly damaging Het
Nlrp4b A G 7: 10,725,943 D824G probably benign Het
Nwd1 A T 8: 72,695,418 M1031L probably benign Het
Olfr1164 T A 2: 88,093,828 Q36L probably benign Het
Olfr1188 A C 2: 88,560,314 I271L probably benign Het
Olfr1286 A T 2: 111,420,360 I197N possibly damaging Het
Olfr1466 A G 19: 13,341,874 T39A possibly damaging Het
Olfr657 C T 7: 104,636,084 R137C probably benign Het
Olfr743 C T 14: 50,533,754 T114I probably benign Het
Pan2 T C 10: 128,315,181 M807T probably damaging Het
Parp8 A T 13: 116,911,415 I222N probably damaging Het
Pmm1 C T 15: 81,955,695 R143H probably damaging Het
Pou1f1 T C 16: 65,531,947 L186P Het
Ppargc1b G A 18: 61,310,659 R494W probably damaging Het
Prg4 G T 1: 150,455,537 P462T unknown Het
Ptcd1 T A 5: 145,154,715 I525L probably benign Het
Ptchd4 A T 17: 42,502,759 Y517F probably damaging Het
Pum1 T C 4: 130,752,861 F693S probably damaging Het
Ribc2 A C 15: 85,137,962 Q186P probably damaging Het
Sesn2 C A 4: 132,496,884 probably null Het
Sgf29 G A 7: 126,672,654 V284M probably damaging Het
Skap2 C T 6: 51,879,770 probably null Het
Smap1 T A 1: 23,922,073 E28V probably damaging Het
Smc3 A G 19: 53,628,769 N538D probably benign Het
Spen T C 4: 141,476,391 T1642A unknown Het
Spred3 G A 7: 29,166,530 R115* probably null Het
Srrm4 TTTCTTCTTCTTCTTCTT TTTCTTCTTCTTCTT 5: 116,475,202 probably benign Het
Sugt1 T A 14: 79,628,853 M304K possibly damaging Het
Sval1 T C 6: 41,951,672 I6T possibly damaging Het
Svil T C 18: 5,097,500 I1574T probably benign Het
Tinag T A 9: 76,997,018 probably null Het
Trak1 T C 9: 121,460,488 L622P probably damaging Het
Ttn C T 2: 76,755,874 D21838N probably damaging Het
Ttn ACCTCCTCCTCCTCCTCCTC ACCTCCTCCTCCTCCTC 2: 76,843,390 probably benign Het
Vmn1r43 G A 6: 89,869,895 T203M probably damaging Het
Vmn1r73 C T 7: 11,756,276 A7V probably benign Het
Yy1 G T 12: 108,793,995 G195C probably benign Het
Zbtb17 T A 4: 141,466,365 C607S possibly damaging Het
Zfp735 T C 11: 73,712,234 V668A probably benign Het
Zfp819 C A 7: 43,617,146 T351K probably damaging Het
Zfp820 C A 17: 21,820,050 S99I possibly damaging Het
Other mutations in Masp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00232:Masp1 APN 16 23458091 missense possibly damaging 0.93
IGL00428:Masp1 APN 16 23476312 missense probably damaging 1.00
IGL00432:Masp1 APN 16 23513851 missense probably damaging 1.00
IGL02598:Masp1 APN 16 23459631 missense probably benign
IGL02718:Masp1 APN 16 23476293 missense probably damaging 1.00
IGL02947:Masp1 APN 16 23494726 missense probably damaging 0.99
A4554:Masp1 UTSW 16 23454940 splice site probably null
PIT1430001:Masp1 UTSW 16 23513944 missense probably damaging 1.00
R0103:Masp1 UTSW 16 23458018 missense probably damaging 1.00
R0505:Masp1 UTSW 16 23458138 missense probably benign
R0630:Masp1 UTSW 16 23452419 missense probably benign 0.01
R1146:Masp1 UTSW 16 23492115 missense probably damaging 1.00
R1146:Masp1 UTSW 16 23492115 missense probably damaging 1.00
R1339:Masp1 UTSW 16 23452467 missense probably damaging 1.00
R1521:Masp1 UTSW 16 23494637 missense probably damaging 1.00
R1588:Masp1 UTSW 16 23494654 missense probably damaging 1.00
R1961:Masp1 UTSW 16 23452932 missense probably damaging 1.00
R1986:Masp1 UTSW 16 23483461 missense probably benign 0.01
R2080:Masp1 UTSW 16 23491959 missense probably damaging 1.00
R2215:Masp1 UTSW 16 23452521 missense possibly damaging 0.92
R2216:Masp1 UTSW 16 23492055 missense probably benign 0.00
R2443:Masp1 UTSW 16 23476312 missense probably damaging 1.00
R4934:Masp1 UTSW 16 23465076 missense probably damaging 0.98
R5224:Masp1 UTSW 16 23494695 missense probably damaging 1.00
R5340:Masp1 UTSW 16 23458108 missense probably damaging 1.00
R5562:Masp1 UTSW 16 23465167 splice site probably null
R5663:Masp1 UTSW 16 23452938 missense possibly damaging 0.57
R5742:Masp1 UTSW 16 23454925 missense probably benign 0.01
R5763:Masp1 UTSW 16 23496247 missense probably damaging 1.00
R5898:Masp1 UTSW 16 23491927 missense probably damaging 0.99
R6901:Masp1 UTSW 16 23513834 missense probably damaging 0.99
R6987:Masp1 UTSW 16 23513915 missense probably damaging 1.00
R7069:Masp1 UTSW 16 23452455 missense probably benign 0.20
R7356:Masp1 UTSW 16 23470243 missense possibly damaging 0.50
R7512:Masp1 UTSW 16 23470124 missense probably damaging 1.00
R7539:Masp1 UTSW 16 23470378 missense possibly damaging 0.94
R7810:Masp1 UTSW 16 23476318 missense probably benign 0.01
R8026:Masp1 UTSW 16 23484406 missense probably damaging 1.00
R8391:Masp1 UTSW 16 23470378 missense possibly damaging 0.94
R8438:Masp1 UTSW 16 23470403 missense probably benign 0.38
R8475:Masp1 UTSW 16 23452531 missense probably damaging 0.99
R8870:Masp1 UTSW 16 23496132 missense probably damaging 1.00
R9052:Masp1 UTSW 16 23520600 start gained probably benign
R9072:Masp1 UTSW 16 23469921 missense probably benign 0.07
X0065:Masp1 UTSW 16 23513969 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTTGGGGCTATCTCAGGAG -3'
(R):5'- TCGGGCAACTACAGTGTCAC -3'

Sequencing Primer
(F):5'- CTATCTCAGGAGCATGAGTGTGC -3'
(R):5'- CAGTGTCACAGAGAACATGTTC -3'
Posted On 2021-12-30