Incidental Mutation 'R8865:En1'
ID 692924
Institutional Source Beutler Lab
Gene Symbol En1
Ensembl Gene ENSMUSG00000058665
Gene Name engrailed 1
Synonyms Mo-en.1, En-1, engrailed-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8865 (G1)
Quality Score 40.0075
Status Validated
Chromosome 1
Chromosomal Location 120602418-120607992 bp(+) (GRCm38)
Type of Mutation start gained
DNA Base Change (assembly) G to T at 120603000 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000078659 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079721]
AlphaFold P09065
Predicted Effect probably benign
Transcript: ENSMUST00000079721
SMART Domains Protein: ENSMUSP00000078659
Gene: ENSMUSG00000058665

DomainStartEndE-ValueType
low complexity region 13 104 N/A INTRINSIC
low complexity region 133 147 N/A INTRINSIC
low complexity region 197 250 N/A INTRINSIC
HOX 312 374 1.11e-24 SMART
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 100% (72/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Homeobox-containing genes are thought to have a role in controlling development. In Drosophila, the 'engrailed' (en) gene plays an important role during development in segmentation, where it is required for the formation of posterior compartments. Different mutations in the mouse homologs, En1 and En2, produced different developmental defects that frequently are lethal. The human engrailed homologs 1 and 2 encode homeodomain-containing proteins and have been implicated in the control of pattern formation during development of the central nervous system. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutant homozygotes usually die within 24 hours of birth. Mutants exhibit nervous system defects, including a lack of most of the colliculi, cerebellum, and the third and fourth cranial nerves in some lines. Skeletal anomalies have also been described. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts2 T A 11: 50,781,744 Y606* probably null Het
Adgrb1 A G 15: 74,543,658 I696V possibly damaging Het
Ass1 A G 2: 31,520,395 Q406R probably benign Het
Calcoco2 GGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC GGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC 11: 96,099,982 probably benign Het
Ccdc148 T C 2: 58,829,820 K409R possibly damaging Het
Ccnl1 A T 3: 65,946,848 S451T probably benign Het
Cdc123 T C 2: 5,795,424 probably benign Het
Cep192 T C 18: 67,834,632 V729A probably benign Het
Chd6 G A 2: 161,021,069 A444V probably benign Het
Chl1 A G 6: 103,708,861 K898E probably damaging Het
Chrng T C 1: 87,207,497 V154A probably damaging Het
Cog1 T G 11: 113,658,498 M799R probably benign Het
Col4a3 G A 1: 82,669,762 probably null Het
Coro6 C A 11: 77,469,091 T366K probably damaging Het
Cwh43 G A 5: 73,441,359 M640I probably benign Het
Cyp2c55 A G 19: 39,031,434 E272G probably benign Het
Cyp4f39 A G 17: 32,483,297 Y256C probably damaging Het
Dbx2 G A 15: 95,632,400 R229* probably null Het
Dcdc2a C T 13: 25,202,283 A380V probably benign Het
F3 T A 3: 121,729,411 V90E probably damaging Het
Fam171a1 A G 2: 3,225,903 K691R probably damaging Het
Foxp2 C T 6: 15,415,094 A609V unknown Het
Hemgn A T 4: 46,396,682 S185T possibly damaging Het
Hk1 C T 10: 62,315,515 D33N probably benign Het
Igfbp1 T A 11: 7,201,929 V244D probably damaging Het
Insr A T 8: 3,161,358 D1160E probably damaging Het
Irs1 A T 1: 82,288,109 Y795* probably null Het
Krtap28-10 T C 1: 83,042,087 K111E unknown Het
Lbx1 T G 19: 45,235,166 D21A probably benign Het
Map6 G T 7: 99,268,985 A322S probably benign Het
Mat1a T C 14: 41,121,831 Y336H probably damaging Het
Mcf2l A G 8: 12,880,003 I8V probably benign Het
Med12l T C 3: 59,071,882 V276A probably benign Het
Mettl17 A G 14: 51,884,851 probably benign Het
Mllt1 T C 17: 56,900,295 D183G possibly damaging Het
Msmb T A 14: 32,150,260 C69* probably null Het
Mterf1a A G 5: 3,891,425 S148P probably damaging Het
Mybl2 A G 2: 163,080,733 I583V probably benign Het
Nbr1 T A 11: 101,564,694 D91E probably benign Het
Notch3 A G 17: 32,122,116 Y2221H probably benign Het
Npat C A 9: 53,570,640 T1216N probably benign Het
Olfr1082 C A 2: 86,594,400 V143F possibly damaging Het
Olfr127 T C 17: 37,904,224 L226P probably damaging Het
Olfr137 T A 17: 38,304,981 H160L probably damaging Het
Pawr T A 10: 108,382,742 Y170N probably damaging Het
Pde12 T C 14: 26,669,125 D143G possibly damaging Het
Phactr2 A G 10: 13,253,732 I264T probably benign Het
Pip5k1b A G 19: 24,397,058 L53P probably damaging Het
Pknox1 T C 17: 31,599,546 I251T probably benign Het
Plcxd1 A T 5: 110,101,975 probably benign Het
Polr3c C T 3: 96,715,201 probably benign Het
Ppil2 T C 16: 17,097,405 N113S probably benign Het
Pramel4 G C 4: 144,068,482 G483R probably damaging Het
Prdm10 T C 9: 31,327,397 L195P probably damaging Het
Prss16 A T 13: 22,003,005 L465Q possibly damaging Het
Psg25 G T 7: 18,529,594 H101Q possibly damaging Het
Pstpip2 A G 18: 77,846,408 D55G possibly damaging Het
Rfc1 A T 5: 65,278,792 D636E possibly damaging Het
Scarf2 G T 16: 17,803,110 C214F probably damaging Het
Sirt4 T C 5: 115,482,645 E156G probably damaging Het
Spag6 C T 2: 18,734,117 S286L probably benign Het
Stx17 T A 4: 48,183,444 H267Q unknown Het
Tekt3 T C 11: 63,070,232 C76R probably benign Het
Tln1 A T 4: 43,538,281 V1807E possibly damaging Het
Tnfrsf21 A G 17: 43,085,481 D552G probably damaging Het
Ttn C A 2: 76,730,320 V29246L possibly damaging Het
Usp43 C A 11: 67,898,962 C252F probably damaging Het
Vmn2r16 T C 5: 109,340,044 I261T probably benign Het
Vwa5b1 T C 4: 138,581,219 E769G probably benign Het
Xrn1 T A 9: 95,991,193 F670Y probably benign Het
Zc3h7b G A 15: 81,772,480 R166Q probably benign Het
Zdhhc14 A T 17: 5,725,295 Y274F possibly damaging Het
Zeb2 T A 2: 44,996,127 M973L probably benign Het
Zfp638 T C 6: 83,977,053 V1380A possibly damaging Het
Other mutations in En1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00672:En1 APN 1 120606938 missense unknown
R1728:En1 UTSW 1 120603621 missense unknown
R1730:En1 UTSW 1 120603621 missense unknown
R1739:En1 UTSW 1 120603621 missense unknown
R1783:En1 UTSW 1 120603621 missense unknown
R1785:En1 UTSW 1 120603621 missense unknown
R1881:En1 UTSW 1 120603175 missense unknown
R1971:En1 UTSW 1 120607013 missense unknown
R2007:En1 UTSW 1 120603404 missense probably benign 0.33
R2279:En1 UTSW 1 120607187 makesense probably null
R4290:En1 UTSW 1 120603757 missense unknown
R4379:En1 UTSW 1 120603355 missense possibly damaging 0.53
R4709:En1 UTSW 1 120607143 missense unknown
R5400:En1 UTSW 1 120603595 missense probably damaging 0.99
R6257:En1 UTSW 1 120603907 missense unknown
R7024:En1 UTSW 1 120603322 missense unknown
R7359:En1 UTSW 1 120607088 missense unknown
R8807:En1 UTSW 1 120603361 missense possibly damaging 0.53
R9168:En1 UTSW 1 120603163 missense unknown
R9339:En1 UTSW 1 120607164 missense unknown
Z1177:En1 UTSW 1 120603453 missense probably benign 0.09
Z1177:En1 UTSW 1 120603663 missense unknown
Z1177:En1 UTSW 1 120607005 missense unknown
Predicted Primers PCR Primer
(F):5'- AGCGAGATTTGCTCCACCAG -3'
(R):5'- ATCGGGCCTTAGGATGTTATC -3'

Sequencing Primer
(F):5'- CACCAGAGCGGGCGAGAG -3'
(R):5'- GCCTTAGGATGTTATCGATGAAAAAG -3'
Posted On 2022-01-07