Incidental Mutation 'R8865:Plcxd1'
ID 692927
Institutional Source Beutler Lab
Gene Symbol Plcxd1
Ensembl Gene ENSMUSG00000064247
Gene Name phosphatidylinositol-specific phospholipase C, X domain containing 1
Synonyms A330045H12Rik, LOC231597
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.090) question?
Stock # R8865 (G1)
Quality Score 188.009
Status Validated
Chromosome 5
Chromosomal Location 110099969-110105953 bp(+) (GRCm38)
Type of Mutation unclassified
DNA Base Change (assembly) A to T at 110101975 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000119248 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077220] [ENSMUST00000086687] [ENSMUST00000112534] [ENSMUST00000135409] [ENSMUST00000140538] [ENSMUST00000141066]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000077220
SMART Domains Protein: ENSMUSP00000076458
Gene: ENSMUSG00000033434

DomainStartEndE-ValueType
low complexity region 50 83 N/A INTRINSIC
Pfam:GTP-bdg_N 107 198 9.1e-15 PFAM
Pfam:GTP-bdg_M 200 279 1.9e-17 PFAM
Pfam:MMR_HSR1 286 404 3.1e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000086687
SMART Domains Protein: ENSMUSP00000083892
Gene: ENSMUSG00000064247

DomainStartEndE-ValueType
SCOP:d2ptd__ 48 355 1e-70 SMART
PDB:1AOD|A 57 228 1e-12 PDB
Blast:PLCXc 70 228 8e-12 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000112534
SMART Domains Protein: ENSMUSP00000108153
Gene: ENSMUSG00000064247

DomainStartEndE-ValueType
SCOP:d2ptd__ 1 111 2e-21 SMART
PDB:1AOD|A 7 95 3e-6 PDB
Blast:PLCXc 15 121 4e-8 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000135409
SMART Domains Protein: ENSMUSP00000117817
Gene: ENSMUSG00000033434

DomainStartEndE-ValueType
low complexity region 162 173 N/A INTRINSIC
coiled coil region 185 218 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000140538
Predicted Effect probably benign
Transcript: ENSMUST00000141066
SMART Domains Protein: ENSMUSP00000119248
Gene: ENSMUSG00000064247

DomainStartEndE-ValueType
SCOP:d2ptd__ 1 97 6e-20 SMART
PDB:1AOD|A 7 95 3e-6 PDB
Blast:PLCXc 15 99 5e-7 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 100% (72/72)
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts2 T A 11: 50,781,744 Y606* probably null Het
Adgrb1 A G 15: 74,543,658 I696V possibly damaging Het
Ass1 A G 2: 31,520,395 Q406R probably benign Het
Calcoco2 GGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC GGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC 11: 96,099,982 probably benign Het
Ccdc148 T C 2: 58,829,820 K409R possibly damaging Het
Ccnl1 A T 3: 65,946,848 S451T probably benign Het
Cdc123 T C 2: 5,795,424 probably benign Het
Cep192 T C 18: 67,834,632 V729A probably benign Het
Chd6 G A 2: 161,021,069 A444V probably benign Het
Chl1 A G 6: 103,708,861 K898E probably damaging Het
Chrng T C 1: 87,207,497 V154A probably damaging Het
Cog1 T G 11: 113,658,498 M799R probably benign Het
Col4a3 G A 1: 82,669,762 probably null Het
Coro6 C A 11: 77,469,091 T366K probably damaging Het
Cwh43 G A 5: 73,441,359 M640I probably benign Het
Cyp2c55 A G 19: 39,031,434 E272G probably benign Het
Cyp4f39 A G 17: 32,483,297 Y256C probably damaging Het
Dbx2 G A 15: 95,632,400 R229* probably null Het
Dcdc2a C T 13: 25,202,283 A380V probably benign Het
En1 G T 1: 120,603,000 probably benign Het
F3 T A 3: 121,729,411 V90E probably damaging Het
Fam171a1 A G 2: 3,225,903 K691R probably damaging Het
Foxp2 C T 6: 15,415,094 A609V unknown Het
Hemgn A T 4: 46,396,682 S185T possibly damaging Het
Hk1 C T 10: 62,315,515 D33N probably benign Het
Igfbp1 T A 11: 7,201,929 V244D probably damaging Het
Insr A T 8: 3,161,358 D1160E probably damaging Het
Irs1 A T 1: 82,288,109 Y795* probably null Het
Krtap28-10 T C 1: 83,042,087 K111E unknown Het
Lbx1 T G 19: 45,235,166 D21A probably benign Het
Map6 G T 7: 99,268,985 A322S probably benign Het
Mat1a T C 14: 41,121,831 Y336H probably damaging Het
Mcf2l A G 8: 12,880,003 I8V probably benign Het
Med12l T C 3: 59,071,882 V276A probably benign Het
Mettl17 A G 14: 51,884,851 probably benign Het
Mllt1 T C 17: 56,900,295 D183G possibly damaging Het
Msmb T A 14: 32,150,260 C69* probably null Het
Mterf1a A G 5: 3,891,425 S148P probably damaging Het
Mybl2 A G 2: 163,080,733 I583V probably benign Het
Nbr1 T A 11: 101,564,694 D91E probably benign Het
Notch3 A G 17: 32,122,116 Y2221H probably benign Het
Npat C A 9: 53,570,640 T1216N probably benign Het
Olfr1082 C A 2: 86,594,400 V143F possibly damaging Het
Olfr127 T C 17: 37,904,224 L226P probably damaging Het
Olfr137 T A 17: 38,304,981 H160L probably damaging Het
Pawr T A 10: 108,382,742 Y170N probably damaging Het
Pde12 T C 14: 26,669,125 D143G possibly damaging Het
Phactr2 A G 10: 13,253,732 I264T probably benign Het
Pip5k1b A G 19: 24,397,058 L53P probably damaging Het
Pknox1 T C 17: 31,599,546 I251T probably benign Het
Polr3c C T 3: 96,715,201 probably benign Het
Ppil2 T C 16: 17,097,405 N113S probably benign Het
Pramel4 G C 4: 144,068,482 G483R probably damaging Het
Prdm10 T C 9: 31,327,397 L195P probably damaging Het
Prss16 A T 13: 22,003,005 L465Q possibly damaging Het
Psg25 G T 7: 18,529,594 H101Q possibly damaging Het
Pstpip2 A G 18: 77,846,408 D55G possibly damaging Het
Rfc1 A T 5: 65,278,792 D636E possibly damaging Het
Scarf2 G T 16: 17,803,110 C214F probably damaging Het
Sirt4 T C 5: 115,482,645 E156G probably damaging Het
Spag6 C T 2: 18,734,117 S286L probably benign Het
Stx17 T A 4: 48,183,444 H267Q unknown Het
Tekt3 T C 11: 63,070,232 C76R probably benign Het
Tln1 A T 4: 43,538,281 V1807E possibly damaging Het
Tnfrsf21 A G 17: 43,085,481 D552G probably damaging Het
Ttn C A 2: 76,730,320 V29246L possibly damaging Het
Usp43 C A 11: 67,898,962 C252F probably damaging Het
Vmn2r16 T C 5: 109,340,044 I261T probably benign Het
Vwa5b1 T C 4: 138,581,219 E769G probably benign Het
Xrn1 T A 9: 95,991,193 F670Y probably benign Het
Zc3h7b G A 15: 81,772,480 R166Q probably benign Het
Zdhhc14 A T 17: 5,725,295 Y274F possibly damaging Het
Zeb2 T A 2: 44,996,127 M973L probably benign Het
Zfp638 T C 6: 83,977,053 V1380A possibly damaging Het
Other mutations in Plcxd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01776:Plcxd1 APN 5 110101380 splice site probably benign
IGL02268:Plcxd1 APN 5 110100274 unclassified probably benign
IGL02870:Plcxd1 APN 5 110101405 missense probably damaging 1.00
R0066:Plcxd1 UTSW 5 110101502 missense probably damaging 1.00
R1366:Plcxd1 UTSW 5 110102230 missense probably damaging 1.00
R1912:Plcxd1 UTSW 5 110103442 missense probably benign 0.01
R2698:Plcxd1 UTSW 5 110102483 missense probably benign 0.31
R5135:Plcxd1 UTSW 5 110101363 intron probably benign
R5604:Plcxd1 UTSW 5 110102585 missense probably benign 0.00
R6190:Plcxd1 UTSW 5 110102603 missense probably damaging 1.00
R6345:Plcxd1 UTSW 5 110100299 missense probably benign 0.33
R6351:Plcxd1 UTSW 5 110102167 splice site probably null
R6696:Plcxd1 UTSW 5 110101885 missense possibly damaging 0.83
R7743:Plcxd1 UTSW 5 110102503 missense possibly damaging 0.95
R7959:Plcxd1 UTSW 5 110103556 missense probably damaging 1.00
R8316:Plcxd1 UTSW 5 110102314 missense probably benign 0.10
R8996:Plcxd1 UTSW 5 110102578 missense probably benign 0.00
R9430:Plcxd1 UTSW 5 110103502 missense probably benign 0.06
R9682:Plcxd1 UTSW 5 110103611 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGTTAGGGCCCTGGTGATG -3'
(R):5'- CACGTCATGGGTTATGTCACGG -3'

Sequencing Primer
(F):5'- TAGGGATCCAGGTGACCCCTAC -3'
(R):5'- GTTCGTGGGTCACATCACAG -3'
Posted On 2022-01-07