Incidental Mutation 'R8928:Tnn'
ID 692946
Institutional Source Beutler Lab
Gene Symbol Tnn
Ensembl Gene ENSMUSG00000026725
Gene Name tenascin N
Synonyms Tnw, tenascin-W
Accession Numbers

Genbank: NM_177839.3; Ensembl: ENSMUST00000039178

Is this an essential gene? Possibly non essential (E-score: 0.423) question?
Stock # R8928 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 160085029-160153580 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 160125529 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 647 (D647G)
Ref Sequence ENSEMBL: ENSMUSP00000039452 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039178] [ENSMUST00000131919]
AlphaFold Q80Z71
Predicted Effect probably damaging
Transcript: ENSMUST00000039178
AA Change: D647G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000039452
Gene: ENSMUSG00000026725
AA Change: D647G

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
coiled coil region 100 132 N/A INTRINSIC
EGF_like 170 198 3.5e1 SMART
EGF 201 229 2.29e1 SMART
EGF_like 232 260 2.86e1 SMART
FN3 262 341 1.81e-8 SMART
FN3 351 432 1.08e-6 SMART
FN3 443 521 1.19e-8 SMART
FN3 531 608 2.64e-10 SMART
FN3 619 696 1.6e-9 SMART
FN3 707 784 9.04e-9 SMART
FN3 795 872 7.34e-9 SMART
FN3 883 960 9.04e-9 SMART
FN3 971 1048 1.07e-10 SMART
FN3 1059 1136 7.57e-11 SMART
FN3 1147 1224 4.59e-10 SMART
FN3 1235 1312 1.95e-4 SMART
FBG 1327 1539 1.16e-114 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000131919
AA Change: D647G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000115685
Gene: ENSMUSG00000026725
AA Change: D647G

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
coiled coil region 100 132 N/A INTRINSIC
EGF_like 170 198 3.5e1 SMART
EGF 201 229 2.29e1 SMART
EGF_like 232 260 2.86e1 SMART
FN3 262 341 1.81e-8 SMART
FN3 351 432 1.08e-6 SMART
FN3 443 521 1.19e-8 SMART
FN3 531 608 2.64e-10 SMART
FN3 619 696 1.6e-9 SMART
FN3 707 784 9.04e-9 SMART
FN3 795 872 7.57e-11 SMART
FN3 883 960 4.59e-10 SMART
FN3 971 1048 1.95e-4 SMART
FBG 1063 1275 1.16e-114 SMART
Meta Mutation Damage Score 0.5937 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (57/57)
Allele List at MGI

All alleles(2) : Targeted, other(2)

Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330182L06Rik T A 5: 9,446,979 H814Q possibly damaging Het
Ahctf1 C A 1: 179,769,061 S1056I possibly damaging Het
Akap13 T A 7: 75,609,858 D743E probably benign Het
Alas1 T A 9: 106,241,314 H203L probably benign Het
Ankfn1 G A 11: 89,538,453 T35I possibly damaging Het
Ankrd11 C T 8: 122,895,979 R378K probably damaging Het
Arap1 G A 7: 101,408,117 R1355Q possibly damaging Het
Cabp7 T A 11: 4,746,640 I30F possibly damaging Het
Ccdc113 T C 8: 95,540,956 probably null Het
Ccdc162 T A 10: 41,586,249 probably benign Het
Cdh1 ACTCGAAATGATGTGGCTC ACTC 8: 106,666,238 probably benign Het
Cep85 G T 4: 134,132,404 H651Q probably benign Het
Cfap43 T A 19: 47,815,960 I266L probably benign Het
Crybg3 T C 16: 59,494,760 T1179A probably benign Het
Crybg3 A G 16: 59,556,352 V1513A probably benign Het
Csmd2 G T 4: 128,475,789 V1905L Het
D630003M21Rik T C 2: 158,217,527 E151G probably damaging Het
Dnah10 A T 5: 124,789,764 Y2306F probably damaging Het
Dpy19l4 A T 4: 11,304,674 probably benign Het
Dsc1 G T 18: 20,110,168 T76K probably benign Het
Egfem1 A C 3: 29,690,412 *591C probably null Het
Epha8 G T 4: 136,938,586 L420M probably damaging Het
Fn1 T C 1: 71,602,618 probably benign Het
Fsd2 T C 7: 81,559,606 T163A probably benign Het
Gm45844 A G 7: 7,278,095 probably benign Het
Gm996 A G 2: 25,578,565 Y445H possibly damaging Het
Grid1 T A 14: 35,580,766 V996D probably benign Het
Hepacam2 C A 6: 3,467,623 probably null Het
Hira A G 16: 18,897,787 T101A probably benign Het
Ighv8-9 T A 12: 115,468,584 T36S possibly damaging Het
Lama5 A T 2: 180,202,039 C413S probably damaging Het
Lpcat2b G T 5: 107,433,047 V81L probably benign Het
Map1b C G 13: 99,432,116 E1366Q unknown Het
March4 C A 1: 72,534,876 A88S probably benign Het
Mbnl2 A G 14: 120,396,562 T324A probably benign Het
Mipol1 T A 12: 57,460,865 M387K probably benign Het
Mtor T C 4: 148,538,899 S2069P probably damaging Het
Mycbp2 T A 14: 103,156,345 T2927S probably benign Het
Nfatc1 A T 18: 80,697,965 N273K possibly damaging Het
Olfr110 A T 17: 37,498,692 I14F probably damaging Het
Olfr1352 A G 10: 78,984,713 K308E Het
Olfr178 T A 16: 58,889,387 T278S possibly damaging Het
Olfr9 T C 10: 128,990,448 C179R probably damaging Het
Olfr913 A T 9: 38,594,366 L48F probably damaging Het
Olfr94 T A 17: 37,196,970 T258S probably damaging Het
Parp16 A G 9: 65,226,114 D79G probably benign Het
Ppp4r3b T C 11: 29,194,598 V316A probably benign Het
Ptcd2 G A 13: 99,339,997 T78I probably damaging Het
Rbpjl A G 2: 164,408,393 Y155C probably damaging Het
Slc5a7 G T 17: 54,284,230 Q225K possibly damaging Het
Stom T C 2: 35,315,925 N264S probably damaging Het
Tbc1d2b C T 9: 90,226,137 E454K probably damaging Het
Tmem209 C T 6: 30,489,366 C495Y probably damaging Het
Vmn2r44 A T 7: 8,378,102 V264E probably damaging Het
Wscd2 A T 5: 113,577,340 I414F possibly damaging Het
Xkr5 A G 8: 18,933,771 V585A probably benign Het
Zfp456 G A 13: 67,366,484 R368C probably benign Het
Zscan18 G A 7: 12,775,193 Q127* probably null Het
Other mutations in Tnn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Tnn APN 1 160125451 missense possibly damaging 0.65
IGL00433:Tnn APN 1 160098206 splice site probably benign
IGL00858:Tnn APN 1 160088392 critical splice donor site probably null
IGL00939:Tnn APN 1 160147530 missense probably damaging 1.00
IGL01569:Tnn APN 1 160120554 missense possibly damaging 0.51
IGL01591:Tnn APN 1 160125574 missense probably damaging 1.00
IGL01628:Tnn APN 1 160147602 missense possibly damaging 0.89
IGL01811:Tnn APN 1 160107135 missense probably damaging 1.00
IGL01813:Tnn APN 1 160088438 missense probably damaging 1.00
IGL02340:Tnn APN 1 160145205 missense probably benign 0.00
IGL02488:Tnn APN 1 160140593 missense probably benign 0.21
IGL02535:Tnn APN 1 160122652 splice site probably null
IGL02563:Tnn APN 1 160114553 missense probably damaging 1.00
IGL02572:Tnn APN 1 160086107 missense probably damaging 1.00
IGL02740:Tnn APN 1 160140777 splice site probably benign
IGL02818:Tnn APN 1 160116278 missense possibly damaging 0.86
IGL03284:Tnn APN 1 160125452 missense probably benign 0.01
1mM(1):Tnn UTSW 1 160097341 missense probably damaging 1.00
PIT4305001:Tnn UTSW 1 160086077 missense possibly damaging 0.91
R0023:Tnn UTSW 1 160104928 missense probably benign 0.00
R0234:Tnn UTSW 1 160088466 missense probably damaging 1.00
R0234:Tnn UTSW 1 160088466 missense probably damaging 1.00
R0316:Tnn UTSW 1 160120567 missense possibly damaging 0.93
R0492:Tnn UTSW 1 160120757 missense probably damaging 0.99
R0547:Tnn UTSW 1 160116337 intron probably benign
R1067:Tnn UTSW 1 160125398 missense probably damaging 1.00
R1563:Tnn UTSW 1 160125415 missense probably damaging 1.00
R1565:Tnn UTSW 1 160097265 missense probably damaging 1.00
R1615:Tnn UTSW 1 160118408 missense possibly damaging 0.93
R1637:Tnn UTSW 1 160147600 missense probably damaging 1.00
R1707:Tnn UTSW 1 160145144 missense probably damaging 1.00
R1758:Tnn UTSW 1 160147584 missense possibly damaging 0.61
R1797:Tnn UTSW 1 160140688 missense probably damaging 1.00
R1847:Tnn UTSW 1 160116182 missense possibly damaging 0.51
R1925:Tnn UTSW 1 160097229 missense probably damaging 1.00
R2182:Tnn UTSW 1 160140600 splice site probably null
R2196:Tnn UTSW 1 160097228 nonsense probably null
R2225:Tnn UTSW 1 160147465 missense probably damaging 1.00
R2227:Tnn UTSW 1 160147465 missense probably damaging 1.00
R2286:Tnn UTSW 1 160110509 missense possibly damaging 0.89
R2850:Tnn UTSW 1 160139287 missense probably benign 0.00
R3110:Tnn UTSW 1 160116286 missense possibly damaging 0.71
R3111:Tnn UTSW 1 160107055 missense probably damaging 0.98
R3112:Tnn UTSW 1 160116286 missense possibly damaging 0.71
R3729:Tnn UTSW 1 160146240 missense probably damaging 1.00
R4183:Tnn UTSW 1 160097355 missense probably damaging 1.00
R4439:Tnn UTSW 1 160116080 missense probably benign
R4441:Tnn UTSW 1 160116080 missense probably benign
R4588:Tnn UTSW 1 160145111 missense probably benign 0.25
R4646:Tnn UTSW 1 160146042 missense probably benign
R4647:Tnn UTSW 1 160146042 missense probably benign
R4648:Tnn UTSW 1 160146042 missense probably benign
R4701:Tnn UTSW 1 160147768 missense possibly damaging 0.72
R4703:Tnn UTSW 1 160116245 missense possibly damaging 0.84
R4737:Tnn UTSW 1 160146089 missense probably damaging 1.00
R4801:Tnn UTSW 1 160145033 missense possibly damaging 0.90
R4802:Tnn UTSW 1 160145033 missense possibly damaging 0.90
R4868:Tnn UTSW 1 160130873 missense possibly damaging 0.64
R4977:Tnn UTSW 1 160120618 missense probably damaging 1.00
R5011:Tnn UTSW 1 160126379 missense possibly damaging 0.89
R5026:Tnn UTSW 1 160146137 missense probably benign 0.00
R5027:Tnn UTSW 1 160145211 missense probably damaging 1.00
R5049:Tnn UTSW 1 160140738 missense probably benign 0.00
R5119:Tnn UTSW 1 160120552 missense probably damaging 0.98
R5128:Tnn UTSW 1 160122894 missense probably damaging 0.98
R5234:Tnn UTSW 1 160144999 missense possibly damaging 0.95
R5398:Tnn UTSW 1 160147522 missense probably benign 0.00
R5424:Tnn UTSW 1 160122702 missense possibly damaging 0.69
R5452:Tnn UTSW 1 160110261 missense probably benign 0.13
R5466:Tnn UTSW 1 160120536 missense possibly damaging 0.93
R6022:Tnn UTSW 1 160110358 missense probably benign 0.00
R6062:Tnn UTSW 1 160098278 missense probably damaging 1.00
R6086:Tnn UTSW 1 160086120 missense probably damaging 1.00
R6132:Tnn UTSW 1 160146071 missense probably damaging 0.96
R6324:Tnn UTSW 1 160145204 missense probably damaging 0.96
R6455:Tnn UTSW 1 160114719 missense probably damaging 1.00
R6563:Tnn UTSW 1 160088398 missense probably damaging 1.00
R6650:Tnn UTSW 1 160114583 missense probably damaging 1.00
R6806:Tnn UTSW 1 160120708 missense possibly damaging 0.95
R6810:Tnn UTSW 1 160104842 missense probably damaging 1.00
R7157:Tnn UTSW 1 160126377 nonsense probably null
R7243:Tnn UTSW 1 160107117 missense probably benign 0.07
R7340:Tnn UTSW 1 160146022 missense probably damaging 0.98
R7472:Tnn UTSW 1 160110347 missense probably benign 0.12
R7502:Tnn UTSW 1 160110359 missense probably benign 0.00
R7527:Tnn UTSW 1 160118504 missense possibly damaging 0.51
R7608:Tnn UTSW 1 160088414 nonsense probably null
R7746:Tnn UTSW 1 160114685 missense probably damaging 0.97
R8096:Tnn UTSW 1 160122841 missense probably damaging 1.00
R8136:Tnn UTSW 1 160107060 missense probably damaging 0.96
R8191:Tnn UTSW 1 160125518 missense probably damaging 1.00
R8334:Tnn UTSW 1 160118483 missense probably damaging 1.00
R8335:Tnn UTSW 1 160118483 missense probably damaging 1.00
R8337:Tnn UTSW 1 160118483 missense probably damaging 1.00
R8338:Tnn UTSW 1 160118483 missense probably damaging 1.00
R8427:Tnn UTSW 1 160130686 missense probably damaging 0.99
R8433:Tnn UTSW 1 160097220 missense possibly damaging 0.81
R8479:Tnn UTSW 1 160122827 missense probably benign 0.06
R8505:Tnn UTSW 1 160146023 missense probably damaging 0.98
R8554:Tnn UTSW 1 160110416 missense probably damaging 1.00
R8717:Tnn UTSW 1 160116276 missense possibly damaging 0.51
R8850:Tnn UTSW 1 160110244 critical splice donor site probably null
R9209:Tnn UTSW 1 160126416 missense probably benign 0.02
X0019:Tnn UTSW 1 160086146 missense probably damaging 1.00
Z1176:Tnn UTSW 1 160146293 missense probably benign
Z1177:Tnn UTSW 1 160126527 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GCAATGCGTGTCCCATTACC -3'
(R):5'- AGGCTTGGCTTGGTAAACC -3'

Sequencing Primer
(F):5'- ATGCGTGTCCCATTACCTGTGG -3'
(R):5'- AACCATTGCCTTGTGCTGAATG -3'
Posted On 2022-01-20