Mutagenetix > Incidental Mutations

Incidental Mutation 'R8928:Mipol1'

692983

Institutional Source

Beutler Lab

Gene Symbol

Mipol1

Ensembl Gene

ENSMUSG00000047022

Gene Name

mirror-image polydactyly 1

Synonyms

1700081O04Rik, 6030439O22Rik, D12Ertd19e

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8928 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

57230427-57497199 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 57460865 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Lysine at position 387 (M387K)

Ref Sequence

ENSEMBL: ENSMUSP00000117005 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000123498] [ENSMUST00000130447] [ENSMUST00000145003] [ENSMUST00000153137]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000123498

SMART Domains

Protein: ENSMUSP00000119636
Gene: ENSMUSG00000047022

Domain	Start	End	E-Value	Type
coiled coil region	70	127	N/A	INTRINSIC
Blast:HNHc	220	265	2e-15	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000130447

SMART Domains

Protein: ENSMUSP00000119918
Gene: ENSMUSG00000047022

Domain	Start	End	E-Value	Type
coiled coil region	70	127	N/A	INTRINSIC
Blast:HNHc	220	265	2e-15	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000145003

SMART Domains

Protein: ENSMUSP00000121617
Gene: ENSMUSG00000047022

Domain	Start	End	E-Value	Type
coiled coil region	70	127	N/A	INTRINSIC
Blast:HNHc	220	265	2e-15	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000153137
AA Change: M387K

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)

SMART Domains

Protein: ENSMUSP00000117005
Gene: ENSMUSG00000047022
AA Change: M387K

Domain	Start	End	E-Value	Type
coiled coil region	70	127	N/A	INTRINSIC
Blast:HNHc	220	265	2e-15	BLAST

Meta Mutation Damage Score

0.0846

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.1%

Validation Efficiency

100% (57/57)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a coiled-coil domain-containing protein. The encoded protein may function as a tumor suppressor. A translocation that results in truncation of the protein encoded by this locus has been associated with mirror-image polydactyly, also known as Laurin-Sandrow Syndrome. Alternatively spliced transcript variants have been described. [provided by RefSeq, Sep 2010]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9330182L06Rik	T	A	5: 9,446,979	H814Q	possibly damaging	Het
Ahctf1	C	A	1: 179,769,061	S1056I	possibly damaging	Het
Akap13	T	A	7: 75,609,858	D743E	probably benign	Het
Alas1	T	A	9: 106,241,314	H203L	probably benign	Het
Ankfn1	G	A	11: 89,538,453	T35I	possibly damaging	Het
Ankrd11	C	T	8: 122,895,979	R378K	probably damaging	Het
Arap1	G	A	7: 101,408,117	R1355Q	possibly damaging	Het
Cabp7	T	A	11: 4,746,640	I30F	possibly damaging	Het
Ccdc113	T	C	8: 95,540,956		probably null	Het
Ccdc162	T	A	10: 41,586,249		probably benign	Het
Cdh1	ACTCGAAATGATGTGGCTC	ACTC	8: 106,666,238		probably benign	Het
Cep85	G	T	4: 134,132,404	H651Q	probably benign	Het
Cfap43	T	A	19: 47,815,960	I266L	probably benign	Het
Crybg3	T	C	16: 59,494,760	T1179A	probably benign	Het
Crybg3	A	G	16: 59,556,352	V1513A	probably benign	Het
Csmd2	G	T	4: 128,475,789	V1905L		Het
D630003M21Rik	T	C	2: 158,217,527	E151G	probably damaging	Het
Dnah10	A	T	5: 124,789,764	Y2306F	probably damaging	Het
Dpy19l4	A	T	4: 11,304,674		probably benign	Het
Dsc1	G	T	18: 20,110,168	T76K	probably benign	Het
Egfem1	A	C	3: 29,690,412	*591C	probably null	Het
Epha8	G	T	4: 136,938,586	L420M	probably damaging	Het
Fn1	T	C	1: 71,602,618		probably benign	Het
Fsd2	T	C	7: 81,559,606	T163A	probably benign	Het
Gm45844	A	G	7: 7,278,095		probably benign	Het
Gm996	A	G	2: 25,578,565	Y445H	possibly damaging	Het
Grid1	T	A	14: 35,580,766	V996D	probably benign	Het
Hepacam2	C	A	6: 3,467,623		probably null	Het
Hira	A	G	16: 18,897,787	T101A	probably benign	Het
Ighv8-9	T	A	12: 115,468,584	T36S	possibly damaging	Het
Lama5	A	T	2: 180,202,039	C413S	probably damaging	Het
Lpcat2b	G	T	5: 107,433,047	V81L	probably benign	Het
Map1b	C	G	13: 99,432,116	E1366Q	unknown	Het
March4	C	A	1: 72,534,876	A88S	probably benign	Het
Mbnl2	A	G	14: 120,396,562	T324A	probably benign	Het
Mtor	T	C	4: 148,538,899	S2069P	probably damaging	Het
Mycbp2	T	A	14: 103,156,345	T2927S	probably benign	Het
Nfatc1	A	T	18: 80,697,965	N273K	possibly damaging	Het
Olfr110	A	T	17: 37,498,692	I14F	probably damaging	Het
Olfr1352	A	G	10: 78,984,713	K308E		Het
Olfr178	T	A	16: 58,889,387	T278S	possibly damaging	Het
Olfr9	T	C	10: 128,990,448	C179R	probably damaging	Het
Olfr913	A	T	9: 38,594,366	L48F	probably damaging	Het
Olfr94	T	A	17: 37,196,970	T258S	probably damaging	Het
Parp16	A	G	9: 65,226,114	D79G	probably benign	Het
Ppp4r3b	T	C	11: 29,194,598	V316A	probably benign	Het
Ptcd2	G	A	13: 99,339,997	T78I	probably damaging	Het
Rbpjl	A	G	2: 164,408,393	Y155C	probably damaging	Het
Slc5a7	G	T	17: 54,284,230	Q225K	possibly damaging	Het
Stom	T	C	2: 35,315,925	N264S	probably damaging	Het
Tbc1d2b	C	T	9: 90,226,137	E454K	probably damaging	Het
Tmem209	C	T	6: 30,489,366	C495Y	probably damaging	Het
Tnn	T	C	1: 160,125,529	D647G	probably damaging	Het
Vmn2r44	A	T	7: 8,378,102	V264E	probably damaging	Het
Wscd2	A	T	5: 113,577,340	I414F	possibly damaging	Het
Xkr5	A	G	8: 18,933,771	V585A	probably benign	Het
Zfp456	G	A	13: 67,366,484	R368C	probably benign	Het
Zscan18	G	A	7: 12,775,193	Q127*	probably null	Het

Other mutations in Mipol1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00719:Mipol1	APN	12	57307353	splice site	probably benign
IGL01139:Mipol1	APN	12	57306035	nonsense	probably null
IGL02679:Mipol1	APN	12	57306043	missense	possibly damaging	0.84
IGL03109:Mipol1	APN	12	57364224	missense	probably benign	0.20
R0001:Mipol1	UTSW	12	57460839	splice site	probably benign
R0220:Mipol1	UTSW	12	57457150	missense	probably damaging	1.00
R0271:Mipol1	UTSW	12	57460954	unclassified	probably benign
R0284:Mipol1	UTSW	12	57457069	missense	probably damaging	0.98
R0496:Mipol1	UTSW	12	57457177	missense	probably damaging	0.99
R0538:Mipol1	UTSW	12	57414411	critical splice donor site	probably null
R1082:Mipol1	UTSW	12	57325616	missense	probably damaging	0.98
R1552:Mipol1	UTSW	12	57306088	missense	possibly damaging	0.86
R1558:Mipol1	UTSW	12	57332341	missense	probably damaging	1.00
R1928:Mipol1	UTSW	12	57332419	missense	probably damaging	1.00
R2104:Mipol1	UTSW	12	57306056	splice site	probably null
R2495:Mipol1	UTSW	12	57460990	splice site	probably benign
R3723:Mipol1	UTSW	12	57457092	missense	probably damaging	1.00
R4431:Mipol1	UTSW	12	57303524	missense	possibly damaging	0.58
R4447:Mipol1	UTSW	12	57352748	intron	probably benign
R4654:Mipol1	UTSW	12	57306132	missense	probably benign	0.22
R4847:Mipol1	UTSW	12	57303496	missense	probably damaging	0.99
R4851:Mipol1	UTSW	12	57332301	missense	probably damaging	1.00
R5113:Mipol1	UTSW	12	57496499	missense	probably benign	0.36
R5668:Mipol1	UTSW	12	57325560	missense	possibly damaging	0.48
R6535:Mipol1	UTSW	12	57306100	missense	possibly damaging	0.95
R7172:Mipol1	UTSW	12	57325535	missense	possibly damaging	0.95
R7191:Mipol1	UTSW	12	57457066	missense	probably benign	0.01
R7560:Mipol1	UTSW	12	57306073	missense	possibly damaging	0.94
R8508:Mipol1	UTSW	12	57306088	missense	possibly damaging	0.86
R8752:Mipol1	UTSW	12	57325581	missense	probably damaging	1.00
R8772:Mipol1	UTSW	12	57325632	missense	probably benign	0.23
R8861:Mipol1	UTSW	12	57306016	missense	probably benign	0.00
R9011:Mipol1	UTSW	12	57457079	missense	probably benign	0.03
R9250:Mipol1	UTSW	12	57414383	missense	probably damaging	1.00
R9383:Mipol1	UTSW	12	57306034	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TCCGCCTTGATGAAGTCCAC -3'
(R):5'- ATGAAAGGCGCCGTTTGAG -3'

Sequencing Primer
(F):5'- GCCTTGATGAAGTCCACTCCTC -3'
(R):5'- AAGGCGCCGTTTGAGAACTC -3'

Posted On

2022-01-20