Incidental Mutation 'R8928:Mipol1'
ID 692983
Institutional Source Beutler Lab
Gene Symbol Mipol1
Ensembl Gene ENSMUSG00000047022
Gene Name mirror-image polydactyly 1
Synonyms 1700081O04Rik, 6030439O22Rik, D12Ertd19e
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8928 (G1)
Quality Score 225.009
Status Validated
Chromosome 12
Chromosomal Location 57230427-57497199 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 57460865 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 387 (M387K)
Ref Sequence ENSEMBL: ENSMUSP00000117005 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000123498] [ENSMUST00000130447] [ENSMUST00000145003] [ENSMUST00000153137]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000123498
SMART Domains Protein: ENSMUSP00000119636
Gene: ENSMUSG00000047022

DomainStartEndE-ValueType
coiled coil region 70 127 N/A INTRINSIC
Blast:HNHc 220 265 2e-15 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000130447
SMART Domains Protein: ENSMUSP00000119918
Gene: ENSMUSG00000047022

DomainStartEndE-ValueType
coiled coil region 70 127 N/A INTRINSIC
Blast:HNHc 220 265 2e-15 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000145003
SMART Domains Protein: ENSMUSP00000121617
Gene: ENSMUSG00000047022

DomainStartEndE-ValueType
coiled coil region 70 127 N/A INTRINSIC
Blast:HNHc 220 265 2e-15 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000153137
AA Change: M387K

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000117005
Gene: ENSMUSG00000047022
AA Change: M387K

DomainStartEndE-ValueType
coiled coil region 70 127 N/A INTRINSIC
Blast:HNHc 220 265 2e-15 BLAST
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a coiled-coil domain-containing protein. The encoded protein may function as a tumor suppressor. A translocation that results in truncation of the protein encoded by this locus has been associated with mirror-image polydactyly, also known as Laurin-Sandrow Syndrome. Alternatively spliced transcript variants have been described. [provided by RefSeq, Sep 2010]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330182L06Rik T A 5: 9,446,979 H814Q possibly damaging Het
Ahctf1 C A 1: 179,769,061 S1056I possibly damaging Het
Akap13 T A 7: 75,609,858 D743E probably benign Het
Alas1 T A 9: 106,241,314 H203L probably benign Het
Ankfn1 G A 11: 89,538,453 T35I possibly damaging Het
Ankrd11 C T 8: 122,895,979 R378K probably damaging Het
Arap1 G A 7: 101,408,117 R1355Q possibly damaging Het
Cabp7 T A 11: 4,746,640 I30F possibly damaging Het
Ccdc113 T C 8: 95,540,956 probably null Het
Ccdc162 T A 10: 41,586,249 probably benign Het
Cdh1 ACTCGAAATGATGTGGCTC ACTC 8: 106,666,238 probably benign Het
Cep85 G T 4: 134,132,404 H651Q probably benign Het
Cfap43 T A 19: 47,815,960 I266L probably benign Het
Crybg3 T C 16: 59,494,760 T1179A probably benign Het
Crybg3 A G 16: 59,556,352 V1513A probably benign Het
Csmd2 G T 4: 128,475,789 V1905L Het
D630003M21Rik T C 2: 158,217,527 E151G probably damaging Het
Dnah10 A T 5: 124,789,764 Y2306F probably damaging Het
Dpy19l4 A T 4: 11,304,674 probably benign Het
Dsc1 G T 18: 20,110,168 T76K probably benign Het
Egfem1 A C 3: 29,690,412 *591C probably null Het
Epha8 G T 4: 136,938,586 L420M probably damaging Het
Fn1 T C 1: 71,602,618 probably benign Het
Fsd2 T C 7: 81,559,606 T163A probably benign Het
Gm45844 A G 7: 7,278,095 probably benign Het
Gm996 A G 2: 25,578,565 Y445H possibly damaging Het
Grid1 T A 14: 35,580,766 V996D probably benign Het
Hepacam2 C A 6: 3,467,623 probably null Het
Hira A G 16: 18,897,787 T101A probably benign Het
Ighv8-9 T A 12: 115,468,584 T36S possibly damaging Het
Lama5 A T 2: 180,202,039 C413S probably damaging Het
Lpcat2b G T 5: 107,433,047 V81L probably benign Het
Map1b C G 13: 99,432,116 E1366Q unknown Het
March4 C A 1: 72,534,876 A88S probably benign Het
Mbnl2 A G 14: 120,396,562 T324A probably benign Het
Mtor T C 4: 148,538,899 S2069P probably damaging Het
Mycbp2 T A 14: 103,156,345 T2927S probably benign Het
Nfatc1 A T 18: 80,697,965 N273K possibly damaging Het
Olfr110 A T 17: 37,498,692 I14F probably damaging Het
Olfr1352 A G 10: 78,984,713 K308E Het
Olfr178 T A 16: 58,889,387 T278S possibly damaging Het
Olfr9 T C 10: 128,990,448 C179R probably damaging Het
Olfr913 A T 9: 38,594,366 L48F probably damaging Het
Olfr94 T A 17: 37,196,970 T258S probably damaging Het
Parp16 A G 9: 65,226,114 D79G probably benign Het
Ppp4r3b T C 11: 29,194,598 V316A probably benign Het
Ptcd2 G A 13: 99,339,997 T78I probably damaging Het
Rbpjl A G 2: 164,408,393 Y155C probably damaging Het
Slc5a7 G T 17: 54,284,230 Q225K possibly damaging Het
Stom T C 2: 35,315,925 N264S probably damaging Het
Tbc1d2b C T 9: 90,226,137 E454K probably damaging Het
Tmem209 C T 6: 30,489,366 C495Y probably damaging Het
Tnn T C 1: 160,125,529 D647G probably damaging Het
Vmn2r44 A T 7: 8,378,102 V264E probably damaging Het
Wscd2 A T 5: 113,577,340 I414F possibly damaging Het
Xkr5 A G 8: 18,933,771 V585A probably benign Het
Zfp456 G A 13: 67,366,484 R368C probably benign Het
Zscan18 G A 7: 12,775,193 Q127* probably null Het
Other mutations in Mipol1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00719:Mipol1 APN 12 57307353 splice site probably benign
IGL01139:Mipol1 APN 12 57306035 nonsense probably null
IGL02679:Mipol1 APN 12 57306043 missense possibly damaging 0.84
IGL03109:Mipol1 APN 12 57364224 missense probably benign 0.20
R0001:Mipol1 UTSW 12 57460839 splice site probably benign
R0220:Mipol1 UTSW 12 57457150 missense probably damaging 1.00
R0271:Mipol1 UTSW 12 57460954 unclassified probably benign
R0284:Mipol1 UTSW 12 57457069 missense probably damaging 0.98
R0496:Mipol1 UTSW 12 57457177 missense probably damaging 0.99
R0538:Mipol1 UTSW 12 57414411 critical splice donor site probably null
R1082:Mipol1 UTSW 12 57325616 missense probably damaging 0.98
R1552:Mipol1 UTSW 12 57306088 missense possibly damaging 0.86
R1558:Mipol1 UTSW 12 57332341 missense probably damaging 1.00
R1928:Mipol1 UTSW 12 57332419 missense probably damaging 1.00
R2104:Mipol1 UTSW 12 57306056 splice site probably null
R2495:Mipol1 UTSW 12 57460990 splice site probably benign
R3723:Mipol1 UTSW 12 57457092 missense probably damaging 1.00
R4431:Mipol1 UTSW 12 57303524 missense possibly damaging 0.58
R4447:Mipol1 UTSW 12 57352748 intron probably benign
R4654:Mipol1 UTSW 12 57306132 missense probably benign 0.22
R4847:Mipol1 UTSW 12 57303496 missense probably damaging 0.99
R4851:Mipol1 UTSW 12 57332301 missense probably damaging 1.00
R5113:Mipol1 UTSW 12 57496499 missense probably benign 0.36
R5668:Mipol1 UTSW 12 57325560 missense possibly damaging 0.48
R6535:Mipol1 UTSW 12 57306100 missense possibly damaging 0.95
R7172:Mipol1 UTSW 12 57325535 missense possibly damaging 0.95
R7191:Mipol1 UTSW 12 57457066 missense probably benign 0.01
R7560:Mipol1 UTSW 12 57306073 missense possibly damaging 0.94
R8508:Mipol1 UTSW 12 57306088 missense possibly damaging 0.86
R8752:Mipol1 UTSW 12 57325581 missense probably damaging 1.00
R8772:Mipol1 UTSW 12 57325632 missense probably benign 0.23
R8861:Mipol1 UTSW 12 57306016 missense probably benign 0.00
R9011:Mipol1 UTSW 12 57457079 missense probably benign 0.03
R9250:Mipol1 UTSW 12 57414383 missense probably damaging 1.00
R9383:Mipol1 UTSW 12 57306034 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCCGCCTTGATGAAGTCCAC -3'
(R):5'- ATGAAAGGCGCCGTTTGAG -3'

Sequencing Primer
(F):5'- GCCTTGATGAAGTCCACTCCTC -3'
(R):5'- AAGGCGCCGTTTGAGAACTC -3'
Posted On 2022-01-20