Mutagenetix > Incidental Mutation

Incidental Mutation 'R8928:Map1b'

692987

Institutional Source

Beutler Lab

Gene Symbol

Map1b

Ensembl Gene

ENSMUSG00000052727

Gene Name

microtubule-associated protein 1B

Synonyms

Mtap1b, MAP5, Mtap-5, Mtap5, LC1

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R8928 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

99421446-99516540 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to G at 99432116 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glutamine at position 1366 (E1366Q)

Ref Sequence

ENSEMBL: ENSMUSP00000068374 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000064762]

AlphaFold

P14873

Predicted Effect

unknown
Transcript: ENSMUST00000064762
AA Change: E1366Q

SMART Domains

Protein: ENSMUSP00000068374
Gene: ENSMUSG00000052727
AA Change: E1366Q

Domain	Start	End	E-Value	Type
low complexity region	41	50	N/A	INTRINSIC
Blast:Lactamase_B	270	514	1e-56	BLAST
low complexity region	578	595	N/A	INTRINSIC
low complexity region	597	617	N/A	INTRINSIC
SCOP:d1gkub2	633	735	8e-4	SMART
low complexity region	771	813	N/A	INTRINSIC
low complexity region	855	866	N/A	INTRINSIC
low complexity region	889	913	N/A	INTRINSIC
low complexity region	935	956	N/A	INTRINSIC
low complexity region	1006	1030	N/A	INTRINSIC
low complexity region	1247	1261	N/A	INTRINSIC
low complexity region	1390	1404	N/A	INTRINSIC
low complexity region	1545	1557	N/A	INTRINSIC
low complexity region	1724	1735	N/A	INTRINSIC
Pfam:MAP1B_neuraxin	1891	1907	1.9e-10	PFAM
Pfam:MAP1B_neuraxin	1908	1924	8.3e-11	PFAM
Pfam:MAP1B_neuraxin	1942	1958	3.1e-9	PFAM
Pfam:MAP1B_neuraxin	1959	1975	6.2e-9	PFAM
Pfam:MAP1B_neuraxin	2027	2043	2.9e-10	PFAM
Pfam:MAP1B_neuraxin	2044	2060	3.9e-9	PFAM
low complexity region	2227	2257	N/A	INTRINSIC
low complexity region	2286	2307	N/A	INTRINSIC
low complexity region	2316	2343	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.1%

Validation Efficiency

100% (57/57)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the microtubule-associated protein family. The proteins of this family are thought to be involved in microtubule assembly, which is an essential step in neurogenesis. The product of this gene is a precursor polypeptide that presumably undergoes proteolytic processing to generate the final MAP1B heavy chain and LC1 light chain. Gene knockout studies of the mouse microtubule-associated protein 1B gene suggested an important role in development and function of the nervous system. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for one knock-out allele die prior to E8.5. While mice homozygous for other knock-out alleles exhibit behavioral, visual system, and nervous system defects. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9330182L06Rik	T	A	5: 9,446,979	H814Q	possibly damaging	Het
Ahctf1	C	A	1: 179,769,061	S1056I	possibly damaging	Het
Akap13	T	A	7: 75,609,858	D743E	probably benign	Het
Alas1	T	A	9: 106,241,314	H203L	probably benign	Het
Ankfn1	G	A	11: 89,538,453	T35I	possibly damaging	Het
Ankrd11	C	T	8: 122,895,979	R378K	probably damaging	Het
Arap1	G	A	7: 101,408,117	R1355Q	possibly damaging	Het
Cabp7	T	A	11: 4,746,640	I30F	possibly damaging	Het
Ccdc113	T	C	8: 95,540,956		probably null	Het
Ccdc162	T	A	10: 41,586,249		probably benign	Het
Cdh1	ACTCGAAATGATGTGGCTC	ACTC	8: 106,666,238		probably benign	Het
Cep85	G	T	4: 134,132,404	H651Q	probably benign	Het
Cfap43	T	A	19: 47,815,960	I266L	probably benign	Het
Crybg3	T	C	16: 59,494,760	T1179A	probably benign	Het
Crybg3	A	G	16: 59,556,352	V1513A	probably benign	Het
Csmd2	G	T	4: 128,475,789	V1905L		Het
D630003M21Rik	T	C	2: 158,217,527	E151G	probably damaging	Het
Dnah10	A	T	5: 124,789,764	Y2306F	probably damaging	Het
Dpy19l4	A	T	4: 11,304,674		probably benign	Het
Dsc1	G	T	18: 20,110,168	T76K	probably benign	Het
Egfem1	A	C	3: 29,690,412	*591C	probably null	Het
Epha8	G	T	4: 136,938,586	L420M	probably damaging	Het
Fn1	T	C	1: 71,602,618		probably benign	Het
Fsd2	T	C	7: 81,559,606	T163A	probably benign	Het
Gm45844	A	G	7: 7,278,095		probably benign	Het
Gm996	A	G	2: 25,578,565	Y445H	possibly damaging	Het
Grid1	T	A	14: 35,580,766	V996D	probably benign	Het
Hepacam2	C	A	6: 3,467,623		probably null	Het
Hira	A	G	16: 18,897,787	T101A	probably benign	Het
Ighv8-9	T	A	12: 115,468,584	T36S	possibly damaging	Het
Lama5	A	T	2: 180,202,039	C413S	probably damaging	Het
Lpcat2b	G	T	5: 107,433,047	V81L	probably benign	Het
March4	C	A	1: 72,534,876	A88S	probably benign	Het
Mbnl2	A	G	14: 120,396,562	T324A	probably benign	Het
Mipol1	T	A	12: 57,460,865	M387K	probably benign	Het
Mtor	T	C	4: 148,538,899	S2069P	probably damaging	Het
Mycbp2	T	A	14: 103,156,345	T2927S	probably benign	Het
Nfatc1	A	T	18: 80,697,965	N273K	possibly damaging	Het
Olfr110	A	T	17: 37,498,692	I14F	probably damaging	Het
Olfr1352	A	G	10: 78,984,713	K308E		Het
Olfr178	T	A	16: 58,889,387	T278S	possibly damaging	Het
Olfr9	T	C	10: 128,990,448	C179R	probably damaging	Het
Olfr913	A	T	9: 38,594,366	L48F	probably damaging	Het
Olfr94	T	A	17: 37,196,970	T258S	probably damaging	Het
Parp16	A	G	9: 65,226,114	D79G	probably benign	Het
Ppp4r3b	T	C	11: 29,194,598	V316A	probably benign	Het
Ptcd2	G	A	13: 99,339,997	T78I	probably damaging	Het
Rbpjl	A	G	2: 164,408,393	Y155C	probably damaging	Het
Slc5a7	G	T	17: 54,284,230	Q225K	possibly damaging	Het
Stom	T	C	2: 35,315,925	N264S	probably damaging	Het
Tbc1d2b	C	T	9: 90,226,137	E454K	probably damaging	Het
Tmem209	C	T	6: 30,489,366	C495Y	probably damaging	Het
Tnn	T	C	1: 160,125,529	D647G	probably damaging	Het
Vmn2r44	A	T	7: 8,378,102	V264E	probably damaging	Het
Wscd2	A	T	5: 113,577,340	I414F	possibly damaging	Het
Xkr5	A	G	8: 18,933,771	V585A	probably benign	Het
Zfp456	G	A	13: 67,366,484	R368C	probably benign	Het
Zscan18	G	A	7: 12,775,193	Q127*	probably null	Het

Other mutations in Map1b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00508:Map1b	APN	13	99429233	missense	unknown
IGL00533:Map1b	APN	13	99432604	missense	unknown
IGL00801:Map1b	APN	13	99430097	missense	unknown
IGL01141:Map1b	APN	13	99434761	missense	probably damaging	1.00
IGL01418:Map1b	APN	13	99431830	missense	unknown
IGL01464:Map1b	APN	13	99432743	missense	unknown
IGL01690:Map1b	APN	13	99435004	missense	probably damaging	1.00
IGL01991:Map1b	APN	13	99429569	missense	unknown
IGL02245:Map1b	APN	13	99431528	missense	unknown
IGL02376:Map1b	APN	13	99435595	missense	probably damaging	1.00
IGL02380:Map1b	APN	13	99431143	missense	unknown
IGL02442:Map1b	APN	13	99508198	missense	probably damaging	1.00
IGL02465:Map1b	APN	13	99433406	missense	unknown
IGL02816:Map1b	APN	13	99441755	missense	probably damaging	1.00
IGL02859:Map1b	APN	13	99433036	missense	unknown
IGL02934:Map1b	APN	13	99435131	missense	probably benign	0.09
IGL02970:Map1b	APN	13	99430734	nonsense	probably null
IGL03148:Map1b	APN	13	99441695	missense	probably damaging	1.00
IGL03401:Map1b	APN	13	99427268	missense	unknown
IGL03138:Map1b	UTSW	13	99425826	missense	unknown
R0006:Map1b	UTSW	13	99435302	missense	probably damaging	1.00
R0006:Map1b	UTSW	13	99435302	missense	probably damaging	1.00
R0035:Map1b	UTSW	13	99435338	missense	probably damaging	1.00
R0069:Map1b	UTSW	13	99429848	missense	unknown
R0315:Map1b	UTSW	13	99431116	missense	unknown
R0539:Map1b	UTSW	13	99434018	missense	unknown
R0548:Map1b	UTSW	13	99431683	missense	unknown
R0613:Map1b	UTSW	13	99441641	missense	probably damaging	1.00
R0730:Map1b	UTSW	13	99429766	nonsense	probably null
R1103:Map1b	UTSW	13	99427466	splice site	probably benign
R1300:Map1b	UTSW	13	99432521	missense	unknown
R1353:Map1b	UTSW	13	99427326	missense	unknown
R1387:Map1b	UTSW	13	99432650	missense	unknown
R1481:Map1b	UTSW	13	99431171	missense	unknown
R1509:Map1b	UTSW	13	99431528	missense	unknown
R1521:Map1b	UTSW	13	99432739	missense	unknown
R1604:Map1b	UTSW	13	99429572	missense	unknown
R1649:Map1b	UTSW	13	99516478	missense	probably benign	0.03
R1651:Map1b	UTSW	13	99432583	missense	unknown
R1661:Map1b	UTSW	13	99431929	missense	unknown
R1665:Map1b	UTSW	13	99431929	missense	unknown
R1770:Map1b	UTSW	13	99430493	missense	unknown
R1926:Map1b	UTSW	13	99430692	missense	unknown
R1928:Map1b	UTSW	13	99430946	missense	unknown
R2093:Map1b	UTSW	13	99429670	missense	unknown
R2110:Map1b	UTSW	13	99431121	missense	unknown
R2116:Map1b	UTSW	13	99430644	missense	unknown
R2164:Map1b	UTSW	13	99429338	missense	unknown
R2207:Map1b	UTSW	13	99431083	missense	unknown
R2273:Map1b	UTSW	13	99432084	missense	unknown
R2443:Map1b	UTSW	13	99430411	missense	unknown
R3054:Map1b	UTSW	13	99432742	missense	unknown
R3766:Map1b	UTSW	13	99434087	missense	unknown
R3911:Map1b	UTSW	13	99431072	missense	unknown
R4005:Map1b	UTSW	13	99429907	missense	unknown
R4130:Map1b	UTSW	13	99431680	missense	unknown
R4513:Map1b	UTSW	13	99444233	missense	probably damaging	1.00
R4613:Map1b	UTSW	13	99430302	nonsense	probably null
R4633:Map1b	UTSW	13	99434942	missense	probably damaging	1.00
R4646:Map1b	UTSW	13	99432469	missense	unknown
R4690:Map1b	UTSW	13	99431068	missense	unknown
R4704:Map1b	UTSW	13	99430475	missense	unknown
R4836:Map1b	UTSW	13	99431054	missense	unknown
R4916:Map1b	UTSW	13	99433300	missense	unknown
R4951:Map1b	UTSW	13	99432427	missense	unknown
R4960:Map1b	UTSW	13	99432212	missense	probably benign	0.23
R4961:Map1b	UTSW	13	99435653	missense	probably damaging	1.00
R5030:Map1b	UTSW	13	99434174	missense	unknown
R5090:Map1b	UTSW	13	99430026	nonsense	probably null
R5469:Map1b	UTSW	13	99429338	missense	unknown
R5820:Map1b	UTSW	13	99432824	missense	unknown
R5885:Map1b	UTSW	13	99430081	missense	unknown
R5915:Map1b	UTSW	13	99430331	missense	unknown
R5923:Map1b	UTSW	13	99433153	missense	unknown
R6063:Map1b	UTSW	13	99431137	missense	unknown
R6102:Map1b	UTSW	13	99425873	missense	unknown
R6218:Map1b	UTSW	13	99433206	missense	unknown
R6435:Map1b	UTSW	13	99516363	missense	probably damaging	0.99
R6663:Map1b	UTSW	13	99430022	missense	unknown
R6765:Map1b	UTSW	13	99425941	missense	unknown
R6860:Map1b	UTSW	13	99434767	missense	probably damaging	1.00
R6997:Map1b	UTSW	13	99430634	missense	unknown
R7001:Map1b	UTSW	13	99430593	missense	unknown
R7310:Map1b	UTSW	13	99433655	missense	unknown
R7349:Map1b	UTSW	13	99433640	missense	unknown
R7448:Map1b	UTSW	13	99508140	missense	probably damaging	0.99
R7449:Map1b	UTSW	13	99508140	missense	probably damaging	0.99
R7452:Map1b	UTSW	13	99508140	missense	probably damaging	0.99
R7810:Map1b	UTSW	13	99431882	missense	unknown
R7820:Map1b	UTSW	13	99431177	missense	unknown
R8396:Map1b	UTSW	13	99434113	missense	unknown
R8470:Map1b	UTSW	13	99516442	missense	probably damaging	0.98
R8535:Map1b	UTSW	13	99435154	missense	probably damaging	1.00
R8777:Map1b	UTSW	13	99430796	missense	unknown
R8777-TAIL:Map1b	UTSW	13	99430796	missense	unknown
R8812:Map1b	UTSW	13	99432815	missense	unknown
R8903:Map1b	UTSW	13	99432509	nonsense	probably null
R8954:Map1b	UTSW	13	99434227	missense	unknown
R9164:Map1b	UTSW	13	99425843	missense	unknown
R9164:Map1b	UTSW	13	99432308	nonsense	probably null
R9190:Map1b	UTSW	13	99435406	missense	probably damaging	0.99
R9334:Map1b	UTSW	13	99431640	missense	unknown
R9339:Map1b	UTSW	13	99431062	missense	unknown
R9357:Map1b	UTSW	13	99430200	nonsense	probably null
R9430:Map1b	UTSW	13	99434108	missense	unknown
RF003:Map1b	UTSW	13	99430750	missense	unknown
X0019:Map1b	UTSW	13	99429968	missense	unknown
X0019:Map1b	UTSW	13	99432412	missense	unknown
Z1088:Map1b	UTSW	13	99508115	missense	probably benign	0.07

Predicted Primers

PCR Primer
(F):5'- TTTCTCTGTCTGGGAAGCCCTG -3'
(R):5'- ATTGTGCCAGTCCTGAGGAG -3'

Sequencing Primer
(F):5'- CCTTCAAAGGGGCTTTCGGAAC -3'
(R):5'- TCCTGAGGAGAAGACCCTG -3'

Posted On

2022-01-20