Incidental Mutation 'R8928:Map1b'
ID 692987
Institutional Source Beutler Lab
Gene Symbol Map1b
Ensembl Gene ENSMUSG00000052727
Gene Name microtubule-associated protein 1B
Synonyms Mtap1b, Mtap-5, MAP5, Mtap5, LC1
MMRRC Submission 068772-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8928 (G1)
Quality Score 225.009
Status Validated
Chromosome 13
Chromosomal Location 99557954-99653048 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to G at 99568624 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glutamine at position 1366 (E1366Q)
Ref Sequence ENSEMBL: ENSMUSP00000068374 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064762]
AlphaFold P14873
Predicted Effect unknown
Transcript: ENSMUST00000064762
AA Change: E1366Q
SMART Domains Protein: ENSMUSP00000068374
Gene: ENSMUSG00000052727
AA Change: E1366Q

DomainStartEndE-ValueType
low complexity region 41 50 N/A INTRINSIC
Blast:Lactamase_B 270 514 1e-56 BLAST
low complexity region 578 595 N/A INTRINSIC
low complexity region 597 617 N/A INTRINSIC
SCOP:d1gkub2 633 735 8e-4 SMART
low complexity region 771 813 N/A INTRINSIC
low complexity region 855 866 N/A INTRINSIC
low complexity region 889 913 N/A INTRINSIC
low complexity region 935 956 N/A INTRINSIC
low complexity region 1006 1030 N/A INTRINSIC
low complexity region 1247 1261 N/A INTRINSIC
low complexity region 1390 1404 N/A INTRINSIC
low complexity region 1545 1557 N/A INTRINSIC
low complexity region 1724 1735 N/A INTRINSIC
Pfam:MAP1B_neuraxin 1891 1907 1.9e-10 PFAM
Pfam:MAP1B_neuraxin 1908 1924 8.3e-11 PFAM
Pfam:MAP1B_neuraxin 1942 1958 3.1e-9 PFAM
Pfam:MAP1B_neuraxin 1959 1975 6.2e-9 PFAM
Pfam:MAP1B_neuraxin 2027 2043 2.9e-10 PFAM
Pfam:MAP1B_neuraxin 2044 2060 3.9e-9 PFAM
low complexity region 2227 2257 N/A INTRINSIC
low complexity region 2286 2307 N/A INTRINSIC
low complexity region 2316 2343 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the microtubule-associated protein family. The proteins of this family are thought to be involved in microtubule assembly, which is an essential step in neurogenesis. The product of this gene is a precursor polypeptide that presumably undergoes proteolytic processing to generate the final MAP1B heavy chain and LC1 light chain. Gene knockout studies of the mouse microtubule-associated protein 1B gene suggested an important role in development and function of the nervous system. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for one knock-out allele die prior to E8.5. While mice homozygous for other knock-out alleles exhibit behavioral, visual system, and nervous system defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahctf1 C A 1: 179,596,626 (GRCm39) S1056I possibly damaging Het
Ajm1 A G 2: 25,468,577 (GRCm39) Y445H possibly damaging Het
Akap13 T A 7: 75,259,606 (GRCm39) D743E probably benign Het
Alas1 T A 9: 106,118,513 (GRCm39) H203L probably benign Het
Ankfn1 G A 11: 89,429,279 (GRCm39) T35I possibly damaging Het
Ankrd11 C T 8: 123,622,718 (GRCm39) R378K probably damaging Het
Arap1 G A 7: 101,057,324 (GRCm39) R1355Q possibly damaging Het
Cabp7 T A 11: 4,696,640 (GRCm39) I30F possibly damaging Het
Ccdc113 T C 8: 96,267,584 (GRCm39) probably null Het
Ccdc162 T A 10: 41,462,245 (GRCm39) probably benign Het
Cdh1 ACTCGAAATGATGTGGCTC ACTC 8: 107,392,870 (GRCm39) probably benign Het
Cep85 G T 4: 133,859,715 (GRCm39) H651Q probably benign Het
Cfap43 T A 19: 47,804,399 (GRCm39) I266L probably benign Het
Crybg3 T C 16: 59,315,123 (GRCm39) T1179A probably benign Het
Crybg3 A G 16: 59,376,715 (GRCm39) V1513A probably benign Het
Csmd2 G T 4: 128,369,582 (GRCm39) V1905L Het
D630003M21Rik T C 2: 158,059,447 (GRCm39) E151G probably damaging Het
Dnah10 A T 5: 124,866,828 (GRCm39) Y2306F probably damaging Het
Dpy19l4 A T 4: 11,304,674 (GRCm39) probably benign Het
Dsc1 G T 18: 20,243,225 (GRCm39) T76K probably benign Het
Egfem1 A C 3: 29,744,561 (GRCm39) *591C probably null Het
Elapor2 T A 5: 9,496,979 (GRCm39) H814Q possibly damaging Het
Epha8 G T 4: 136,665,897 (GRCm39) L420M probably damaging Het
Fn1 T C 1: 71,641,777 (GRCm39) probably benign Het
Fsd2 T C 7: 81,209,354 (GRCm39) T163A probably benign Het
Gm45844 A G 7: 7,281,094 (GRCm39) probably benign Het
Grid1 T A 14: 35,302,723 (GRCm39) V996D probably benign Het
Hepacam2 C A 6: 3,467,623 (GRCm39) probably null Het
Hira A G 16: 18,716,537 (GRCm39) T101A probably benign Het
Ighv8-9 T A 12: 115,432,204 (GRCm39) T36S possibly damaging Het
Lama5 A T 2: 179,843,832 (GRCm39) C413S probably damaging Het
Lpcat2b G T 5: 107,580,913 (GRCm39) V81L probably benign Het
Marchf4 C A 1: 72,574,035 (GRCm39) A88S probably benign Het
Mbnl2 A G 14: 120,633,974 (GRCm39) T324A probably benign Het
Mipol1 T A 12: 57,507,651 (GRCm39) M387K probably benign Het
Mtor T C 4: 148,623,356 (GRCm39) S2069P probably damaging Het
Mycbp2 T A 14: 103,393,781 (GRCm39) T2927S probably benign Het
Nfatc1 A T 18: 80,741,180 (GRCm39) N273K possibly damaging Het
Or10p22 T C 10: 128,826,317 (GRCm39) C179R probably damaging Het
Or2i1 T A 17: 37,507,861 (GRCm39) T258S probably damaging Het
Or5k15 T A 16: 58,709,750 (GRCm39) T278S possibly damaging Het
Or5v1 A T 17: 37,809,583 (GRCm39) I14F probably damaging Het
Or7a36 A G 10: 78,820,547 (GRCm39) K308E Het
Or8b49 A T 9: 38,505,662 (GRCm39) L48F probably damaging Het
Parp16 A G 9: 65,133,396 (GRCm39) D79G probably benign Het
Ppp4r3b T C 11: 29,144,598 (GRCm39) V316A probably benign Het
Ptcd2 G A 13: 99,476,505 (GRCm39) T78I probably damaging Het
Rbpjl A G 2: 164,250,313 (GRCm39) Y155C probably damaging Het
Slc5a7 G T 17: 54,591,258 (GRCm39) Q225K possibly damaging Het
Stom T C 2: 35,205,937 (GRCm39) N264S probably damaging Het
Tbc1d2b C T 9: 90,108,190 (GRCm39) E454K probably damaging Het
Tmem209 C T 6: 30,489,365 (GRCm39) C495Y probably damaging Het
Tnn T C 1: 159,953,099 (GRCm39) D647G probably damaging Het
Vmn2r44 A T 7: 8,381,101 (GRCm39) V264E probably damaging Het
Wscd2 A T 5: 113,715,401 (GRCm39) I414F possibly damaging Het
Xkr5 A G 8: 18,983,787 (GRCm39) V585A probably benign Het
Zfp456 G A 13: 67,514,603 (GRCm39) R368C probably benign Het
Zscan18 G A 7: 12,509,120 (GRCm39) Q127* probably null Het
Other mutations in Map1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00508:Map1b APN 13 99,565,741 (GRCm39) missense unknown
IGL00533:Map1b APN 13 99,569,112 (GRCm39) missense unknown
IGL00801:Map1b APN 13 99,566,605 (GRCm39) missense unknown
IGL01141:Map1b APN 13 99,571,269 (GRCm39) missense probably damaging 1.00
IGL01418:Map1b APN 13 99,568,338 (GRCm39) missense unknown
IGL01464:Map1b APN 13 99,569,251 (GRCm39) missense unknown
IGL01690:Map1b APN 13 99,571,512 (GRCm39) missense probably damaging 1.00
IGL01991:Map1b APN 13 99,566,077 (GRCm39) missense unknown
IGL02245:Map1b APN 13 99,568,036 (GRCm39) missense unknown
IGL02376:Map1b APN 13 99,572,103 (GRCm39) missense probably damaging 1.00
IGL02380:Map1b APN 13 99,567,651 (GRCm39) missense unknown
IGL02442:Map1b APN 13 99,644,706 (GRCm39) missense probably damaging 1.00
IGL02465:Map1b APN 13 99,569,914 (GRCm39) missense unknown
IGL02816:Map1b APN 13 99,578,263 (GRCm39) missense probably damaging 1.00
IGL02859:Map1b APN 13 99,569,544 (GRCm39) missense unknown
IGL02934:Map1b APN 13 99,571,639 (GRCm39) missense probably benign 0.09
IGL02970:Map1b APN 13 99,567,242 (GRCm39) nonsense probably null
IGL03148:Map1b APN 13 99,578,203 (GRCm39) missense probably damaging 1.00
IGL03401:Map1b APN 13 99,563,776 (GRCm39) missense unknown
IGL03138:Map1b UTSW 13 99,562,334 (GRCm39) missense unknown
R0006:Map1b UTSW 13 99,571,810 (GRCm39) missense probably damaging 1.00
R0006:Map1b UTSW 13 99,571,810 (GRCm39) missense probably damaging 1.00
R0035:Map1b UTSW 13 99,571,846 (GRCm39) missense probably damaging 1.00
R0069:Map1b UTSW 13 99,566,356 (GRCm39) missense unknown
R0315:Map1b UTSW 13 99,567,624 (GRCm39) missense unknown
R0539:Map1b UTSW 13 99,570,526 (GRCm39) missense unknown
R0548:Map1b UTSW 13 99,568,191 (GRCm39) missense unknown
R0613:Map1b UTSW 13 99,578,149 (GRCm39) missense probably damaging 1.00
R0730:Map1b UTSW 13 99,566,274 (GRCm39) nonsense probably null
R1103:Map1b UTSW 13 99,563,974 (GRCm39) splice site probably benign
R1300:Map1b UTSW 13 99,569,029 (GRCm39) missense unknown
R1353:Map1b UTSW 13 99,563,834 (GRCm39) missense unknown
R1387:Map1b UTSW 13 99,569,158 (GRCm39) missense unknown
R1481:Map1b UTSW 13 99,567,679 (GRCm39) missense unknown
R1509:Map1b UTSW 13 99,568,036 (GRCm39) missense unknown
R1521:Map1b UTSW 13 99,569,247 (GRCm39) missense unknown
R1604:Map1b UTSW 13 99,566,080 (GRCm39) missense unknown
R1649:Map1b UTSW 13 99,652,986 (GRCm39) missense probably benign 0.03
R1651:Map1b UTSW 13 99,569,091 (GRCm39) missense unknown
R1661:Map1b UTSW 13 99,568,437 (GRCm39) missense unknown
R1665:Map1b UTSW 13 99,568,437 (GRCm39) missense unknown
R1770:Map1b UTSW 13 99,567,001 (GRCm39) missense unknown
R1926:Map1b UTSW 13 99,567,200 (GRCm39) missense unknown
R1928:Map1b UTSW 13 99,567,454 (GRCm39) missense unknown
R2093:Map1b UTSW 13 99,566,178 (GRCm39) missense unknown
R2110:Map1b UTSW 13 99,567,629 (GRCm39) missense unknown
R2116:Map1b UTSW 13 99,567,152 (GRCm39) missense unknown
R2164:Map1b UTSW 13 99,565,846 (GRCm39) missense unknown
R2207:Map1b UTSW 13 99,567,591 (GRCm39) missense unknown
R2273:Map1b UTSW 13 99,568,592 (GRCm39) missense unknown
R2443:Map1b UTSW 13 99,566,919 (GRCm39) missense unknown
R3054:Map1b UTSW 13 99,569,250 (GRCm39) missense unknown
R3766:Map1b UTSW 13 99,570,595 (GRCm39) missense unknown
R3911:Map1b UTSW 13 99,567,580 (GRCm39) missense unknown
R4005:Map1b UTSW 13 99,566,415 (GRCm39) missense unknown
R4130:Map1b UTSW 13 99,568,188 (GRCm39) missense unknown
R4513:Map1b UTSW 13 99,580,741 (GRCm39) missense probably damaging 1.00
R4613:Map1b UTSW 13 99,566,810 (GRCm39) nonsense probably null
R4633:Map1b UTSW 13 99,571,450 (GRCm39) missense probably damaging 1.00
R4646:Map1b UTSW 13 99,568,977 (GRCm39) missense unknown
R4690:Map1b UTSW 13 99,567,576 (GRCm39) missense unknown
R4704:Map1b UTSW 13 99,566,983 (GRCm39) missense unknown
R4836:Map1b UTSW 13 99,567,562 (GRCm39) missense unknown
R4916:Map1b UTSW 13 99,569,808 (GRCm39) missense unknown
R4951:Map1b UTSW 13 99,568,935 (GRCm39) missense unknown
R4960:Map1b UTSW 13 99,568,720 (GRCm39) missense probably benign 0.23
R4961:Map1b UTSW 13 99,572,161 (GRCm39) missense probably damaging 1.00
R5030:Map1b UTSW 13 99,570,682 (GRCm39) missense unknown
R5090:Map1b UTSW 13 99,566,534 (GRCm39) nonsense probably null
R5469:Map1b UTSW 13 99,565,846 (GRCm39) missense unknown
R5820:Map1b UTSW 13 99,569,332 (GRCm39) missense unknown
R5885:Map1b UTSW 13 99,566,589 (GRCm39) missense unknown
R5915:Map1b UTSW 13 99,566,839 (GRCm39) missense unknown
R5923:Map1b UTSW 13 99,569,661 (GRCm39) missense unknown
R6063:Map1b UTSW 13 99,567,645 (GRCm39) missense unknown
R6102:Map1b UTSW 13 99,562,381 (GRCm39) missense unknown
R6218:Map1b UTSW 13 99,569,714 (GRCm39) missense unknown
R6435:Map1b UTSW 13 99,652,871 (GRCm39) missense probably damaging 0.99
R6663:Map1b UTSW 13 99,566,530 (GRCm39) missense unknown
R6765:Map1b UTSW 13 99,562,449 (GRCm39) missense unknown
R6860:Map1b UTSW 13 99,571,275 (GRCm39) missense probably damaging 1.00
R6997:Map1b UTSW 13 99,567,142 (GRCm39) missense unknown
R7001:Map1b UTSW 13 99,567,101 (GRCm39) missense unknown
R7310:Map1b UTSW 13 99,570,163 (GRCm39) missense unknown
R7349:Map1b UTSW 13 99,570,148 (GRCm39) missense unknown
R7448:Map1b UTSW 13 99,644,648 (GRCm39) missense probably damaging 0.99
R7449:Map1b UTSW 13 99,644,648 (GRCm39) missense probably damaging 0.99
R7452:Map1b UTSW 13 99,644,648 (GRCm39) missense probably damaging 0.99
R7810:Map1b UTSW 13 99,568,390 (GRCm39) missense unknown
R7820:Map1b UTSW 13 99,567,685 (GRCm39) missense unknown
R8396:Map1b UTSW 13 99,570,621 (GRCm39) missense unknown
R8470:Map1b UTSW 13 99,652,950 (GRCm39) missense probably damaging 0.98
R8535:Map1b UTSW 13 99,571,662 (GRCm39) missense probably damaging 1.00
R8777:Map1b UTSW 13 99,567,304 (GRCm39) missense unknown
R8777-TAIL:Map1b UTSW 13 99,567,304 (GRCm39) missense unknown
R8812:Map1b UTSW 13 99,569,323 (GRCm39) missense unknown
R8903:Map1b UTSW 13 99,569,017 (GRCm39) nonsense probably null
R8954:Map1b UTSW 13 99,570,735 (GRCm39) missense unknown
R9164:Map1b UTSW 13 99,568,816 (GRCm39) nonsense probably null
R9164:Map1b UTSW 13 99,562,351 (GRCm39) missense unknown
R9190:Map1b UTSW 13 99,571,914 (GRCm39) missense probably damaging 0.99
R9334:Map1b UTSW 13 99,568,148 (GRCm39) missense unknown
R9339:Map1b UTSW 13 99,567,570 (GRCm39) missense unknown
R9357:Map1b UTSW 13 99,566,708 (GRCm39) nonsense probably null
R9430:Map1b UTSW 13 99,570,616 (GRCm39) missense unknown
RF003:Map1b UTSW 13 99,567,258 (GRCm39) missense unknown
X0019:Map1b UTSW 13 99,568,920 (GRCm39) missense unknown
X0019:Map1b UTSW 13 99,566,476 (GRCm39) missense unknown
Z1088:Map1b UTSW 13 99,644,623 (GRCm39) missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- TTTCTCTGTCTGGGAAGCCCTG -3'
(R):5'- ATTGTGCCAGTCCTGAGGAG -3'

Sequencing Primer
(F):5'- CCTTCAAAGGGGCTTTCGGAAC -3'
(R):5'- TCCTGAGGAGAAGACCCTG -3'
Posted On 2022-01-20