Mutagenetix > Incidental Mutation

Incidental Mutation 'R9124:Shroom3'

693079

Institutional Source

Beutler Lab

Gene Symbol

Shroom3

Ensembl Gene

ENSMUSG00000029381

Gene Name

shroom family member 3

Synonyms

D5Ertd287e, Shrm3, Shrm

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R9124 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

92683435-92965318 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 92964542 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Glutamic Acid at position 1921 (K1921E)

Ref Sequence

ENSEMBL: ENSMUSP00000108678 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000113051] [ENSMUST00000113054] [ENSMUST00000113055] [ENSMUST00000168878] [ENSMUST00000225438]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000113051
AA Change: K1746E

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000108674
Gene: ENSMUSG00000029381
AA Change: K1746E

Domain	Start	End	E-Value	Type
low complexity region	16	27	N/A	INTRINSIC
low complexity region	83	93	N/A	INTRINSIC
low complexity region	572	586	N/A	INTRINSIC
low complexity region	621	639	N/A	INTRINSIC
low complexity region	685	704	N/A	INTRINSIC
Pfam:ASD1	706	885	2.3e-65	PFAM
low complexity region	939	952	N/A	INTRINSIC
low complexity region	1132	1143	N/A	INTRINSIC
low complexity region	1172	1184	N/A	INTRINSIC
low complexity region	1274	1288	N/A	INTRINSIC
low complexity region	1333	1345	N/A	INTRINSIC
Pfam:ASD2	1478	1765	3.1e-107	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000113054
AA Change: K1746E

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000108677
Gene: ENSMUSG00000029381
AA Change: K1746E

Domain	Start	End	E-Value	Type
low complexity region	16	27	N/A	INTRINSIC
low complexity region	83	93	N/A	INTRINSIC
low complexity region	572	586	N/A	INTRINSIC
low complexity region	621	639	N/A	INTRINSIC
low complexity region	685	704	N/A	INTRINSIC
Pfam:ASD1	706	885	2.3e-65	PFAM
low complexity region	939	952	N/A	INTRINSIC
low complexity region	1132	1143	N/A	INTRINSIC
low complexity region	1172	1184	N/A	INTRINSIC
low complexity region	1274	1288	N/A	INTRINSIC
low complexity region	1333	1345	N/A	INTRINSIC
Pfam:ASD2	1478	1765	3.1e-107	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000113055
AA Change: K1921E

PolyPhen 2 Score 0.193 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000108678
Gene: ENSMUSG00000029381
AA Change: K1921E

Domain	Start	End	E-Value	Type
PDZ	35	109	5.81e-11	SMART
low complexity region	191	202	N/A	INTRINSIC
low complexity region	258	268	N/A	INTRINSIC
low complexity region	747	761	N/A	INTRINSIC
low complexity region	796	814	N/A	INTRINSIC
low complexity region	860	879	N/A	INTRINSIC
Pfam:ASD1	882	1060	1e-57	PFAM
low complexity region	1114	1127	N/A	INTRINSIC
low complexity region	1307	1318	N/A	INTRINSIC
low complexity region	1347	1359	N/A	INTRINSIC
low complexity region	1449	1463	N/A	INTRINSIC
low complexity region	1508	1520	N/A	INTRINSIC
Pfam:ASD2	1654	1940	9.9e-112	PFAM

Predicted Effect

unknown
Transcript: ENSMUST00000168878
AA Change: K1790E

SMART Domains

Protein: ENSMUSP00000130419
Gene: ENSMUSG00000029381
AA Change: K1790E

Domain	Start	End	E-Value	Type
PDZ	35	109	5.81e-11	SMART
low complexity region	191	202	N/A	INTRINSIC
low complexity region	258	268	N/A	INTRINSIC
low complexity region	747	761	N/A	INTRINSIC
low complexity region	796	814	N/A	INTRINSIC
low complexity region	860	879	N/A	INTRINSIC
low complexity region	983	996	N/A	INTRINSIC
low complexity region	1176	1187	N/A	INTRINSIC
low complexity region	1216	1228	N/A	INTRINSIC
low complexity region	1318	1332	N/A	INTRINSIC
low complexity region	1377	1389	N/A	INTRINSIC
Pfam:ASD2	1522	1809	8.9e-108	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000225438
AA Change: K1840E

PolyPhen 2 Score 0.043 (Sensitivity: 0.94; Specificity: 0.83)

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

100% (91/91)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a PDZ-domain-containing protein that belongs to a family of Shroom-related proteins. This protein may be involved in regulating cell shape in certain tissues. A similar protein in mice is required for proper neurulation. [provided by RefSeq, Jan 2011]
PHENOTYPE: Homozygous mutation of this locus results in failed neural tube closure leading to exencephaly, acrania, facial clefting, and spina bifida. Homozygotes develop to term but die either at birth or shortly thereafter. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 95 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A1bg	G	T	15: 60,920,830	N89K	possibly damaging	Het
Abca5	A	T	11: 110,298,179	D817E	possibly damaging	Het
Abca8b	G	A	11: 109,937,767	S1435F	probably damaging	Het
Akap9	T	C	5: 4,061,284	L3115P	probably damaging	Het
Arhgap39	G	A	15: 76,735,267	R706W	probably damaging	Het
BC048403	C	T	10: 121,750,511	Q244*	probably null	Het
BC061237	A	T	14: 44,503,394	I84F	possibly damaging	Het
Bhlhe22	T	C	3: 18,055,178	S131P	probably damaging	Het
Brinp1	C	A	4: 68,829,345	D174Y	probably damaging	Het
Bsdc1	A	G	4: 129,465,275	T40A	probably benign	Het
Ccdc65	A	T	15: 98,720,982	K281*	probably null	Het
Cd22	T	C	7: 30,873,237	I316V	probably benign	Het
Cfap100	A	C	6: 90,409,348	I275S		Het
Chd3	T	G	11: 69,369,336	E19A	unknown	Het
Chrnb1	T	C	11: 69,794,231	D91G	probably benign	Het
Cr1l	A	G	1: 195,117,617	S250P	possibly damaging	Het
Csmd1	A	G	8: 15,984,806	V2455A	probably damaging	Het
Dbp	C	T	7: 45,708,394	R229C	probably damaging	Het
Dmxl1	C	G	18: 49,939,572	N2744K	probably damaging	Het
Dnah6	C	A	6: 73,121,899	V2058F	possibly damaging	Het
Dsp	T	A	13: 38,193,300	V1687D	probably benign	Het
Dtd1	T	A	2: 144,603,878	M45K	possibly damaging	Het
Fat1	T	A	8: 44,950,326	F38Y	probably benign	Het
Fat1	T	A	8: 45,025,027	V2370E	possibly damaging	Het
Fgfr1	T	A	8: 25,570,169	D438E	probably damaging	Het
Fsip2	A	T	2: 82,985,759	K3945N	probably benign	Het
Galc	C	A	12: 98,254,164		probably null	Het
Git1	C	A	11: 77,504,672	D398E	possibly damaging	Het
Gm12569	T	C	11: 51,234,654	S135P	probably benign	Het
Gm281	A	G	14: 13,864,354	F324S		Het
Gm4924	A	G	10: 82,379,041	Q891R	unknown	Het
Gm5724	A	G	6: 141,723,104	V534A	possibly damaging	Het
Gm765	T	A	6: 98,341,938	N22I	possibly damaging	Het
Gm884	T	C	11: 103,618,895	Y749C	unknown	Het
Gpc2	T	C	5: 138,276,522		probably benign	Het
Havcr2	C	T	11: 46,469,561	T205I	probably benign	Het
Herc2	A	G	7: 56,184,308	N3087S	probably damaging	Het
Ifi204	C	T	1: 173,751,627		probably null	Het
Imp4	C	T	1: 34,440,047	R4W	unknown	Het
Itfg2	A	G	6: 128,424,807	S3P	probably damaging	Het
Kcnn3	C	T	3: 89,521,229	T254I	possibly damaging	Het
Kpna1	A	G	16: 36,033,274	I425V	probably benign	Het
Krt23	A	T	11: 99,492,929	S46T	probably damaging	Het
Loxl4	C	A	19: 42,607,660	W118L	probably damaging	Het
Lysmd2	T	A	9: 75,625,793	L10Q	probably damaging	Het
Mcm5	T	A	8: 75,124,790		probably benign	Het
Mctp2	T	A	7: 72,259,430	D45V	probably damaging	Het
Mfsd10	T	C	5: 34,634,596	T341A	probably benign	Het
Micu1	T	A	10: 59,750,513	L170Q	probably damaging	Het
Muc5ac	T	C	7: 141,809,792	I2280T	unknown	Het
Myo15	A	T	11: 60,479,126	Q904L	probably benign	Het
Myo6	G	A	9: 80,288,071	D908N	unknown	Het
Nlrp4e	A	T	7: 23,320,978	M297L	probably benign	Het
Nptn	A	G	9: 58,651,215		probably benign	Het
Oas3	A	C	5: 120,774,105	D73E	probably damaging	Het
Olfr213	A	T	6: 116,540,455	M1L	probably null	Het
Olfr429	T	C	1: 174,089,775	L245P	probably damaging	Het
Olfr536	T	A	7: 140,504,309	H50L	probably benign	Het
Olfr619	A	T	7: 103,603,656	M1L	probably benign	Het
Papd4	A	T	13: 93,147,652	L465*	probably null	Het
Pck1	C	G	2: 173,155,225	A220G	probably benign	Het
Pigq	G	A	17: 25,937,259	T65I	probably damaging	Het
Pld2	T	C	11: 70,540,870	F9L	probably damaging	Het
Plk3	ACACTCAC	ACAC	4: 117,131,893		probably benign	Het
Pnkd	A	G	1: 74,347,443	R138G	possibly damaging	Het
Ralgapa1	A	T	12: 55,735,096	I781N	probably damaging	Het
Ranbp2	A	G	10: 58,492,897	I2873V	probably benign	Het
Rpn2	C	A	2: 157,297,538	Q283K	probably benign	Het
Shmt2	A	G	10: 127,519,692	S178P	possibly damaging	Het
Slc20a1	A	G	2: 129,209,222	S600G	probably damaging	Het
Slit1	C	T	19: 41,606,512	V1140I	probably benign	Het
Sncg	T	C	14: 34,373,683	S51G	possibly damaging	Het
Spon2	C	A	5: 33,215,591	D256Y	possibly damaging	Het
Srcap	G	T	7: 127,560,702	R3250L	unknown	Het
Sun1	T	G	5: 139,245,366	Y763*	probably null	Het
Synj1	A	T	16: 90,938,625	F1480Y	probably benign	Het
Tbc1d30	T	A	10: 121,296,811	N216I	probably damaging	Het
Tgfb1	A	T	7: 25,689,155	K39*	probably null	Het
Tmem87a	A	G	2: 120,394,360		probably null	Het
Tmem8b	C	A	4: 43,681,982	R452S	probably benign	Het
Tnfsf13b	A	G	8: 10,006,966	I42V	probably benign	Het
Trpc2	A	G	7: 102,095,883	T769A	possibly damaging	Het
Ttc3	A	G	16: 94,435,530	T1033A	probably benign	Het
Ttll13	C	T	7: 80,257,003	A473V	probably damaging	Het
U2surp	G	A	9: 95,464,415	R908*	probably null	Het
Ube2s	A	G	7: 4,811,511	Y17H	probably damaging	Het
Usmg5	T	C	19: 47,086,139	M28V	probably benign	Het
Vmn1r94	A	T	7: 20,167,584	M265K	probably benign	Het
Vmn2r23	T	C	6: 123,742,079	I797T	possibly damaging	Het
Yipf3	A	T	17: 46,248,969	E70D	probably benign	Het
Zcchc14	G	A	8: 121,605,230	P465S	unknown	Het
Zfp169	T	C	13: 48,491,081	E190G	unknown	Het
Zfp707	T	C	15: 75,973,619	S111P		Het
Zfp738	T	C	13: 67,671,338	E178G	possibly damaging	Het
Zfr	A	T	15: 12,136,671	N138I	unknown	Het

Other mutations in Shroom3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00850:Shroom3	APN	5	92951065	missense	probably damaging	1.00
IGL01086:Shroom3	APN	5	92948452	missense	probably benign	0.01
IGL01363:Shroom3	APN	5	92940993	missense	probably benign	0.01
IGL01468:Shroom3	APN	5	92940342	missense	probably damaging	1.00
IGL01675:Shroom3	APN	5	92941680	missense	probably damaging	0.99
IGL01862:Shroom3	APN	5	92962289	missense	probably damaging	1.00
IGL01987:Shroom3	APN	5	92942189	missense	probably damaging	0.99
IGL02104:Shroom3	APN	5	92940389	missense	probably benign	0.32
IGL03248:Shroom3	APN	5	92952540	missense	probably benign	0.00
IGL03386:Shroom3	APN	5	92948483	splice site	probably benign
R0167:Shroom3	UTSW	5	92948395	splice site	probably benign
R0388:Shroom3	UTSW	5	92951293	missense	probably benign	0.39
R0395:Shroom3	UTSW	5	92780903	missense	probably damaging	1.00
R0567:Shroom3	UTSW	5	92964453	missense	possibly damaging	0.53
R1496:Shroom3	UTSW	5	92942834	missense	possibly damaging	0.69
R1772:Shroom3	UTSW	5	92940656	missense	probably damaging	0.97
R1845:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R1921:Shroom3	UTSW	5	92962365	critical splice donor site	probably null
R2059:Shroom3	UTSW	5	92683784	missense	probably damaging	1.00
R2203:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R2204:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R2205:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R2301:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R2344:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R2345:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R2346:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R2348:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R2371:Shroom3	UTSW	5	92780870	missense	probably damaging	1.00
R2435:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R2829:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R2830:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R2831:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R2897:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R2898:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R3079:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R3080:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R3433:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R3729:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R3730:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R3735:Shroom3	UTSW	5	92964444	missense	possibly damaging	0.84
R3736:Shroom3	UTSW	5	92964444	missense	possibly damaging	0.84
R3851:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R3852:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R3943:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R3969:Shroom3	UTSW	5	92940879	missense	probably benign	0.05
R4008:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4009:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4012:Shroom3	UTSW	5	92948483	splice site	probably benign
R4154:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4157:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4172:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4173:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4201:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4202:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4204:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4205:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4206:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4284:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4285:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4364:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4384:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4456:Shroom3	UTSW	5	92940999	missense	probably benign	0.14
R4707:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4712:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4751:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4755:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4760:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4773:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4774:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4776:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4801:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4802:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4856:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4857:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4860:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4860:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4882:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4883:Shroom3	UTSW	5	92951134	missense	probably benign	0.14
R4886:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R5262:Shroom3	UTSW	5	92964573	missense	probably damaging	1.00
R5271:Shroom3	UTSW	5	92962248	missense	probably damaging	1.00
R5719:Shroom3	UTSW	5	92943018	missense	probably benign	0.04
R5726:Shroom3	UTSW	5	92943005	missense	probably benign	0.00
R5993:Shroom3	UTSW	5	92940188	missense	probably damaging	1.00
R6078:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R6079:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R6138:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R6153:Shroom3	UTSW	5	92964408	missense	probably damaging	0.99
R6493:Shroom3	UTSW	5	92941561	missense	probably benign	0.03
R6495:Shroom3	UTSW	5	92942069	missense	possibly damaging	0.66
R6693:Shroom3	UTSW	5	92940758	missense	possibly damaging	0.61
R6801:Shroom3	UTSW	5	92940936	missense	probably damaging	1.00
R6893:Shroom3	UTSW	5	92942204	missense	probably damaging	0.97
R6912:Shroom3	UTSW	5	92943017	missense	probably benign	0.02
R6924:Shroom3	UTSW	5	92964403	missense	probably damaging	1.00
R7083:Shroom3	UTSW	5	92964525	missense	probably damaging	1.00
R7197:Shroom3	UTSW	5	92942604	missense	probably damaging	1.00
R7366:Shroom3	UTSW	5	92964606	nonsense	probably null
R7712:Shroom3	UTSW	5	92950947	missense	probably benign	0.01
R7725:Shroom3	UTSW	5	92941653	missense	probably benign	0.19
R7728:Shroom3	UTSW	5	92683707	missense	possibly damaging	0.73
R7774:Shroom3	UTSW	5	92950489	missense	probably damaging	0.98
R7795:Shroom3	UTSW	5	92919649	missense	probably damaging	0.99
R7821:Shroom3	UTSW	5	92940846	missense	probably damaging	0.98
R7971:Shroom3	UTSW	5	92951074	missense	probably damaging	1.00
R8276:Shroom3	UTSW	5	92940480	missense	probably damaging	0.99
R8934:Shroom3	UTSW	5	92941725	missense	probably damaging	1.00
R8938:Shroom3	UTSW	5	92943071	missense	probably damaging	1.00
R9083:Shroom3	UTSW	5	92950674	missense	probably damaging	0.97
R9108:Shroom3	UTSW	5	92940116	missense	probably damaging	1.00
R9295:Shroom3	UTSW	5	92950619	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- AAAGGAAGGTTCTGGCTGGC -3'
(R):5'- CGCTTTCAGATTGAACAGTGGTG -3'

Sequencing Primer
(F):5'- CTGGCCAGCATGAGGATG -3'
(R):5'- TTCAGATTGAACAGTGGTGAGAGTG -3'

Posted On

2022-01-20