Incidental Mutation 'R9124:Oas3'
ID 693080
Institutional Source Beutler Lab
Gene Symbol Oas3
Ensembl Gene ENSMUSG00000032661
Gene Name 2'-5' oligoadenylate synthetase 3
Synonyms Oasl10, 2'-5' oligoadenylate synthetase-like 10
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.099) question?
Stock # R9124 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 120753098-120777661 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to C at 120774105 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 73 (D73E)
Ref Sequence ENSEMBL: ENSMUSP00000035588 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044833]
AlphaFold Q8VI93
Predicted Effect probably damaging
Transcript: ENSMUST00000044833
AA Change: D73E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000035588
Gene: ENSMUSG00000032661
AA Change: D73E

DomainStartEndE-ValueType
Pfam:OAS1_C 159 341 6.3e-83 PFAM
Pfam:OAS1_C 610 795 3.1e-78 PFAM
Pfam:NTP_transf_2 831 920 4.5e-11 PFAM
Pfam:OAS1_C 954 1136 9e-85 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme included in the 2', 5' oligoadenylate synthase family. This enzyme is induced by interferons and catalyzes the 2', 5' oligomers of adenosine in order to bind and activate RNase L. This enzyme family plays a significant role in the inhibition of cellular protein synthesis and viral infection resistance. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1bg G T 15: 60,920,830 N89K possibly damaging Het
Abca5 A T 11: 110,298,179 D817E possibly damaging Het
Abca8b G A 11: 109,937,767 S1435F probably damaging Het
Akap9 T C 5: 4,061,284 L3115P probably damaging Het
Arhgap39 G A 15: 76,735,267 R706W probably damaging Het
BC048403 C T 10: 121,750,511 Q244* probably null Het
BC061237 A T 14: 44,503,394 I84F possibly damaging Het
Bhlhe22 T C 3: 18,055,178 S131P probably damaging Het
Brinp1 C A 4: 68,829,345 D174Y probably damaging Het
Bsdc1 A G 4: 129,465,275 T40A probably benign Het
Ccdc65 A T 15: 98,720,982 K281* probably null Het
Cd22 T C 7: 30,873,237 I316V probably benign Het
Cfap100 A C 6: 90,409,348 I275S Het
Chd3 T G 11: 69,369,336 E19A unknown Het
Chrnb1 T C 11: 69,794,231 D91G probably benign Het
Cr1l A G 1: 195,117,617 S250P possibly damaging Het
Csmd1 A G 8: 15,984,806 V2455A probably damaging Het
Dbp C T 7: 45,708,394 R229C probably damaging Het
Dmxl1 C G 18: 49,939,572 N2744K probably damaging Het
Dnah6 C A 6: 73,121,899 V2058F possibly damaging Het
Dsp T A 13: 38,193,300 V1687D probably benign Het
Dtd1 T A 2: 144,603,878 M45K possibly damaging Het
Fat1 T A 8: 44,950,326 F38Y probably benign Het
Fat1 T A 8: 45,025,027 V2370E possibly damaging Het
Fgfr1 T A 8: 25,570,169 D438E probably damaging Het
Fsip2 A T 2: 82,985,759 K3945N probably benign Het
Galc C A 12: 98,254,164 probably null Het
Git1 C A 11: 77,504,672 D398E possibly damaging Het
Gm12569 T C 11: 51,234,654 S135P probably benign Het
Gm281 A G 14: 13,864,354 F324S Het
Gm4924 A G 10: 82,379,041 Q891R unknown Het
Gm5724 A G 6: 141,723,104 V534A possibly damaging Het
Gm765 T A 6: 98,341,938 N22I possibly damaging Het
Gm884 T C 11: 103,618,895 Y749C unknown Het
Havcr2 C T 11: 46,469,561 T205I probably benign Het
Herc2 A G 7: 56,184,308 N3087S probably damaging Het
Ifi204 C T 1: 173,751,627 probably null Het
Imp4 C T 1: 34,440,047 R4W unknown Het
Itfg2 A G 6: 128,424,807 S3P probably damaging Het
Kcnn3 C T 3: 89,521,229 T254I possibly damaging Het
Kpna1 A G 16: 36,033,274 I425V probably benign Het
Krt23 A T 11: 99,492,929 S46T probably damaging Het
Loxl4 C A 19: 42,607,660 W118L probably damaging Het
Lysmd2 T A 9: 75,625,793 L10Q probably damaging Het
Mctp2 T A 7: 72,259,430 D45V probably damaging Het
Mfsd10 T C 5: 34,634,596 T341A probably benign Het
Micu1 T A 10: 59,750,513 L170Q probably damaging Het
Muc5ac T C 7: 141,809,792 I2280T unknown Het
Myo15 A T 11: 60,479,126 Q904L probably benign Het
Myo6 G A 9: 80,288,071 D908N unknown Het
Nlrp4e A T 7: 23,320,978 M297L probably benign Het
Olfr213 A T 6: 116,540,455 M1L probably null Het
Olfr429 T C 1: 174,089,775 L245P probably damaging Het
Olfr536 T A 7: 140,504,309 H50L probably benign Het
Olfr619 A T 7: 103,603,656 M1L probably benign Het
Papd4 A T 13: 93,147,652 L465* probably null Het
Pck1 C G 2: 173,155,225 A220G probably benign Het
Pigq G A 17: 25,937,259 T65I probably damaging Het
Pld2 T C 11: 70,540,870 F9L probably damaging Het
Plk3 ACACTCAC ACAC 4: 117,131,893 probably benign Het
Pnkd A G 1: 74,347,443 R138G possibly damaging Het
Ralgapa1 A T 12: 55,735,096 I781N probably damaging Het
Ranbp2 A G 10: 58,492,897 I2873V probably benign Het
Rpn2 C A 2: 157,297,538 Q283K probably benign Het
Shmt2 A G 10: 127,519,692 S178P possibly damaging Het
Shroom3 A G 5: 92,964,542 K1921E probably benign Het
Slc20a1 A G 2: 129,209,222 S600G probably damaging Het
Slit1 C T 19: 41,606,512 V1140I probably benign Het
Sncg T C 14: 34,373,683 S51G possibly damaging Het
Spon2 C A 5: 33,215,591 D256Y possibly damaging Het
Srcap G T 7: 127,560,702 R3250L unknown Het
Sun1 T G 5: 139,245,366 Y763* probably null Het
Synj1 A T 16: 90,938,625 F1480Y probably benign Het
Tbc1d30 T A 10: 121,296,811 N216I probably damaging Het
Tmem87a A G 2: 120,394,360 probably null Het
Tmem8b C A 4: 43,681,982 R452S probably benign Het
Tnfsf13b A G 8: 10,006,966 I42V probably benign Het
Trpc2 A G 7: 102,095,883 T769A possibly damaging Het
Ttc3 A G 16: 94,435,530 T1033A probably benign Het
Ttll13 C T 7: 80,257,003 A473V probably damaging Het
U2surp G A 9: 95,464,415 R908* probably null Het
Ube2s A G 7: 4,811,511 Y17H probably damaging Het
Usmg5 T C 19: 47,086,139 M28V probably benign Het
Vmn1r94 A T 7: 20,167,584 M265K probably benign Het
Vmn2r23 T C 6: 123,742,079 I797T possibly damaging Het
Yipf3 A T 17: 46,248,969 E70D probably benign Het
Zcchc14 G A 8: 121,605,230 P465S unknown Het
Zfp169 T C 13: 48,491,081 E190G unknown Het
Zfp707 T C 15: 75,973,619 S111P Het
Zfp738 T C 13: 67,671,338 E178G possibly damaging Het
Zfr A T 15: 12,136,671 N138I unknown Het
Other mutations in Oas3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00547:Oas3 APN 5 120777442 splice site probably benign
IGL01095:Oas3 APN 5 120772889 missense probably damaging 1.00
IGL01835:Oas3 APN 5 120766128 nonsense probably null
IGL02006:Oas3 APN 5 120769235 missense probably benign 0.00
IGL02811:Oas3 APN 5 120764322 missense unknown
IGL03194:Oas3 APN 5 120758953 missense probably damaging 1.00
R0066:Oas3 UTSW 5 120758875 missense probably damaging 1.00
R0195:Oas3 UTSW 5 120756145 missense probably damaging 1.00
R0196:Oas3 UTSW 5 120756145 missense probably damaging 1.00
R0197:Oas3 UTSW 5 120756145 missense probably damaging 1.00
R0445:Oas3 UTSW 5 120756145 missense probably damaging 1.00
R0523:Oas3 UTSW 5 120766144 missense unknown
R0592:Oas3 UTSW 5 120771149 missense probably damaging 1.00
R0946:Oas3 UTSW 5 120769063 missense unknown
R1354:Oas3 UTSW 5 120770000 missense possibly damaging 0.94
R1642:Oas3 UTSW 5 120777574 missense possibly damaging 0.90
R1681:Oas3 UTSW 5 120769908 missense probably benign 0.22
R1844:Oas3 UTSW 5 120759980 missense probably damaging 0.99
R1981:Oas3 UTSW 5 120761835 splice site probably benign
R2443:Oas3 UTSW 5 120777488 missense probably benign 0.35
R2902:Oas3 UTSW 5 120758917 missense probably damaging 1.00
R3034:Oas3 UTSW 5 120771056 missense probably damaging 1.00
R4565:Oas3 UTSW 5 120771039 missense probably damaging 1.00
R4692:Oas3 UTSW 5 120769355 missense probably benign 0.03
R4723:Oas3 UTSW 5 120766256 missense unknown
R4812:Oas3 UTSW 5 120761147 unclassified probably benign
R5288:Oas3 UTSW 5 120756990 missense probably damaging 1.00
R5343:Oas3 UTSW 5 120756238 missense possibly damaging 0.70
R5494:Oas3 UTSW 5 120761644 missense unknown
R5688:Oas3 UTSW 5 120758802 missense probably benign 0.31
R5894:Oas3 UTSW 5 120756954 missense probably damaging 1.00
R5921:Oas3 UTSW 5 120769981 missense probably damaging 1.00
R6037:Oas3 UTSW 5 120769319 missense probably benign 0.41
R6037:Oas3 UTSW 5 120769319 missense probably benign 0.41
R6066:Oas3 UTSW 5 120772924 missense probably damaging 0.97
R6104:Oas3 UTSW 5 120761693 missense unknown
R6134:Oas3 UTSW 5 120769048 missense unknown
R6255:Oas3 UTSW 5 120771230 missense probably benign 0.04
R6257:Oas3 UTSW 5 120761135 unclassified probably benign
R6776:Oas3 UTSW 5 120758874 missense probably damaging 1.00
R8022:Oas3 UTSW 5 120756966 missense possibly damaging 0.91
R8137:Oas3 UTSW 5 120777500 missense probably benign 0.07
R8967:Oas3 UTSW 5 120758842 missense probably damaging 0.99
R9287:Oas3 UTSW 5 120754689 missense probably damaging 1.00
RF006:Oas3 UTSW 5 120774100 missense probably damaging 1.00
X0024:Oas3 UTSW 5 120761728 missense unknown
Predicted Primers PCR Primer
(F):5'- AAACTGTAAGATCCTGGACGC -3'
(R):5'- AGTCTTTCTCCAAGCTCAAGCC -3'

Sequencing Primer
(F):5'- GTAAGATCCTGGACGCCTTTGAC -3'
(R):5'- ACGCTGGTTCTACCTGGTGAC -3'
Posted On 2022-01-20