Incidental Mutation 'R9124:Dnah6'
ID 693082
Institutional Source Beutler Lab
Gene Symbol Dnah6
Ensembl Gene ENSMUSG00000052861
Gene Name dynein, axonemal, heavy chain 6
Synonyms A730004I20Rik, Dnahc6
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.118) question?
Stock # R9124 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 73017606-73221651 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 73121899 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Phenylalanine at position 2058 (V2058F)
Ref Sequence ENSEMBL: ENSMUSP00000068758 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064948] [ENSMUST00000114040] [ENSMUST00000204053]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000064948
AA Change: V2058F

PolyPhen 2 Score 0.780 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000068758
Gene: ENSMUSG00000052861
AA Change: V2058F

DomainStartEndE-ValueType
coiled coil region 732 759 N/A INTRINSIC
low complexity region 841 852 N/A INTRINSIC
Pfam:DHC_N2 875 1298 4.3e-144 PFAM
AAA 1459 1562 2.76e-1 SMART
AAA 1740 1881 5.25e-1 SMART
low complexity region 1957 1967 N/A INTRINSIC
AAA 2083 2236 1.01e-3 SMART
AAA 2434 2592 3.08e0 SMART
low complexity region 2607 2618 N/A INTRINSIC
low complexity region 2645 2656 N/A INTRINSIC
Pfam:MT 2685 3019 3.1e-53 PFAM
Pfam:AAA_9 3040 3265 3.6e-94 PFAM
Pfam:Dynein_heavy 3402 4140 1.2e-250 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000114040
AA Change: V2006F

PolyPhen 2 Score 0.655 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000109674
Gene: ENSMUSG00000052861
AA Change: V2006F

DomainStartEndE-ValueType
coiled coil region 732 759 N/A INTRINSIC
low complexity region 841 852 N/A INTRINSIC
Pfam:DHC_N2 873 1300 2.2e-135 PFAM
AAA 1407 1510 2.76e-1 SMART
AAA 1688 1829 5.25e-1 SMART
low complexity region 1905 1915 N/A INTRINSIC
AAA 2031 2184 1.01e-3 SMART
AAA 2382 2540 3.08e0 SMART
low complexity region 2555 2566 N/A INTRINSIC
low complexity region 2593 2604 N/A INTRINSIC
Pfam:MT 2633 2967 1.1e-53 PFAM
Pfam:AAA_9 2984 3214 1e-58 PFAM
Pfam:Dynein_heavy 3344 4089 2.2e-213 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000204053
AA Change: V2058F

PolyPhen 2 Score 0.780 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000144791
Gene: ENSMUSG00000052861
AA Change: V2058F

DomainStartEndE-ValueType
coiled coil region 732 759 N/A INTRINSIC
low complexity region 841 852 N/A INTRINSIC
Pfam:DHC_N2 875 1298 4.3e-144 PFAM
AAA 1459 1562 2.76e-1 SMART
AAA 1740 1881 5.25e-1 SMART
low complexity region 1957 1967 N/A INTRINSIC
AAA 2083 2236 1.01e-3 SMART
AAA 2434 2592 3.08e0 SMART
low complexity region 2607 2618 N/A INTRINSIC
low complexity region 2645 2656 N/A INTRINSIC
Pfam:MT 2685 3019 3.1e-53 PFAM
Pfam:AAA_9 3040 3265 3.6e-94 PFAM
Pfam:Dynein_heavy 3402 4140 1.2e-250 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the dynein family, whose members encode large proteins that are constituents of the microtubule-associated motor protein complex. This complex is composed of dynein heavy, intermediate and light chains, which can be axonemal or cytoplasmic. This protein is an axonemal dynein heavy chain. It is involved in producing force for ciliary beating by using energy from ATP hydrolysis. Mutations in this gene may cause primary ciliary dyskinesia (PCD) as well as heterotaxy. [provided by RefSeq, Jun 2016]
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1bg G T 15: 60,920,830 N89K possibly damaging Het
Abca5 A T 11: 110,298,179 D817E possibly damaging Het
Abca8b G A 11: 109,937,767 S1435F probably damaging Het
Akap9 T C 5: 4,061,284 L3115P probably damaging Het
Arhgap39 G A 15: 76,735,267 R706W probably damaging Het
BC048403 C T 10: 121,750,511 Q244* probably null Het
BC061237 A T 14: 44,503,394 I84F possibly damaging Het
Bhlhe22 T C 3: 18,055,178 S131P probably damaging Het
Brinp1 C A 4: 68,829,345 D174Y probably damaging Het
Bsdc1 A G 4: 129,465,275 T40A probably benign Het
Ccdc65 A T 15: 98,720,982 K281* probably null Het
Cd22 T C 7: 30,873,237 I316V probably benign Het
Cfap100 A C 6: 90,409,348 I275S Het
Chd3 T G 11: 69,369,336 E19A unknown Het
Chrnb1 T C 11: 69,794,231 D91G probably benign Het
Cr1l A G 1: 195,117,617 S250P possibly damaging Het
Csmd1 A G 8: 15,984,806 V2455A probably damaging Het
Dbp C T 7: 45,708,394 R229C probably damaging Het
Dmxl1 C G 18: 49,939,572 N2744K probably damaging Het
Dsp T A 13: 38,193,300 V1687D probably benign Het
Dtd1 T A 2: 144,603,878 M45K possibly damaging Het
Fat1 T A 8: 44,950,326 F38Y probably benign Het
Fat1 T A 8: 45,025,027 V2370E possibly damaging Het
Fgfr1 T A 8: 25,570,169 D438E probably damaging Het
Fsip2 A T 2: 82,985,759 K3945N probably benign Het
Galc C A 12: 98,254,164 probably null Het
Git1 C A 11: 77,504,672 D398E possibly damaging Het
Gm12569 T C 11: 51,234,654 S135P probably benign Het
Gm281 A G 14: 13,864,354 F324S Het
Gm4924 A G 10: 82,379,041 Q891R unknown Het
Gm5724 A G 6: 141,723,104 V534A possibly damaging Het
Gm765 T A 6: 98,341,938 N22I possibly damaging Het
Gm884 T C 11: 103,618,895 Y749C unknown Het
Havcr2 C T 11: 46,469,561 T205I probably benign Het
Herc2 A G 7: 56,184,308 N3087S probably damaging Het
Ifi204 C T 1: 173,751,627 probably null Het
Imp4 C T 1: 34,440,047 R4W unknown Het
Itfg2 A G 6: 128,424,807 S3P probably damaging Het
Kcnn3 C T 3: 89,521,229 T254I possibly damaging Het
Kpna1 A G 16: 36,033,274 I425V probably benign Het
Krt23 A T 11: 99,492,929 S46T probably damaging Het
Loxl4 C A 19: 42,607,660 W118L probably damaging Het
Lysmd2 T A 9: 75,625,793 L10Q probably damaging Het
Mctp2 T A 7: 72,259,430 D45V probably damaging Het
Mfsd10 T C 5: 34,634,596 T341A probably benign Het
Micu1 T A 10: 59,750,513 L170Q probably damaging Het
Muc5ac T C 7: 141,809,792 I2280T unknown Het
Myo15 A T 11: 60,479,126 Q904L probably benign Het
Myo6 G A 9: 80,288,071 D908N unknown Het
Nlrp4e A T 7: 23,320,978 M297L probably benign Het
Oas3 A C 5: 120,774,105 D73E probably damaging Het
Olfr213 A T 6: 116,540,455 M1L probably null Het
Olfr429 T C 1: 174,089,775 L245P probably damaging Het
Olfr536 T A 7: 140,504,309 H50L probably benign Het
Olfr619 A T 7: 103,603,656 M1L probably benign Het
Papd4 A T 13: 93,147,652 L465* probably null Het
Pck1 C G 2: 173,155,225 A220G probably benign Het
Pigq G A 17: 25,937,259 T65I probably damaging Het
Pld2 T C 11: 70,540,870 F9L probably damaging Het
Plk3 ACACTCAC ACAC 4: 117,131,893 probably benign Het
Pnkd A G 1: 74,347,443 R138G possibly damaging Het
Ralgapa1 A T 12: 55,735,096 I781N probably damaging Het
Ranbp2 A G 10: 58,492,897 I2873V probably benign Het
Rpn2 C A 2: 157,297,538 Q283K probably benign Het
Shmt2 A G 10: 127,519,692 S178P possibly damaging Het
Shroom3 A G 5: 92,964,542 K1921E probably benign Het
Slc20a1 A G 2: 129,209,222 S600G probably damaging Het
Slit1 C T 19: 41,606,512 V1140I probably benign Het
Sncg T C 14: 34,373,683 S51G possibly damaging Het
Spon2 C A 5: 33,215,591 D256Y possibly damaging Het
Srcap G T 7: 127,560,702 R3250L unknown Het
Sun1 T G 5: 139,245,366 Y763* probably null Het
Synj1 A T 16: 90,938,625 F1480Y probably benign Het
Tbc1d30 T A 10: 121,296,811 N216I probably damaging Het
Tmem87a A G 2: 120,394,360 probably null Het
Tmem8b C A 4: 43,681,982 R452S probably benign Het
Tnfsf13b A G 8: 10,006,966 I42V probably benign Het
Trpc2 A G 7: 102,095,883 T769A possibly damaging Het
Ttc3 A G 16: 94,435,530 T1033A probably benign Het
Ttll13 C T 7: 80,257,003 A473V probably damaging Het
U2surp G A 9: 95,464,415 R908* probably null Het
Ube2s A G 7: 4,811,511 Y17H probably damaging Het
Usmg5 T C 19: 47,086,139 M28V probably benign Het
Vmn1r94 A T 7: 20,167,584 M265K probably benign Het
Vmn2r23 T C 6: 123,742,079 I797T possibly damaging Het
Yipf3 A T 17: 46,248,969 E70D probably benign Het
Zcchc14 G A 8: 121,605,230 P465S unknown Het
Zfp169 T C 13: 48,491,081 E190G unknown Het
Zfp707 T C 15: 75,973,619 S111P Het
Zfp738 T C 13: 67,671,338 E178G possibly damaging Het
Zfr A T 15: 12,136,671 N138I unknown Het
Other mutations in Dnah6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00264:Dnah6 APN 6 73195737 missense probably benign 0.00
IGL00488:Dnah6 APN 6 73086207 missense possibly damaging 0.95
IGL00497:Dnah6 APN 6 73195761 missense probably damaging 1.00
IGL00557:Dnah6 APN 6 73195620 missense possibly damaging 0.47
IGL00561:Dnah6 APN 6 73195620 missense possibly damaging 0.47
IGL00563:Dnah6 APN 6 73195620 missense possibly damaging 0.47
IGL00755:Dnah6 APN 6 73212434 critical splice donor site probably null
IGL00756:Dnah6 APN 6 73123771 missense possibly damaging 0.76
IGL00764:Dnah6 APN 6 73195620 missense possibly damaging 0.47
IGL00895:Dnah6 APN 6 73156350 missense possibly damaging 0.67
IGL00922:Dnah6 APN 6 73033526 splice site probably benign
IGL00972:Dnah6 APN 6 73083157 splice site probably benign
IGL00975:Dnah6 APN 6 73173390 missense possibly damaging 0.94
IGL01014:Dnah6 APN 6 73074781 splice site probably benign
IGL01307:Dnah6 APN 6 73065725 missense probably damaging 1.00
IGL01353:Dnah6 APN 6 73173456 missense probably benign 0.01
IGL01362:Dnah6 APN 6 73092178 missense probably damaging 1.00
IGL01373:Dnah6 APN 6 73074748 missense probably benign 0.10
IGL01559:Dnah6 APN 6 73024252 critical splice donor site probably null
IGL01622:Dnah6 APN 6 73144718 missense probably damaging 1.00
IGL01623:Dnah6 APN 6 73144718 missense probably damaging 1.00
IGL01682:Dnah6 APN 6 73075802 missense probably damaging 1.00
IGL01735:Dnah6 APN 6 73076660 nonsense probably null
IGL01736:Dnah6 APN 6 73188377 missense probably benign 0.06
IGL01825:Dnah6 APN 6 73065776 missense probably damaging 1.00
IGL01835:Dnah6 APN 6 73135801 missense probably damaging 1.00
IGL01870:Dnah6 APN 6 73032569 missense probably benign 0.04
IGL01935:Dnah6 APN 6 73060143 missense probably benign
IGL02126:Dnah6 APN 6 73103166 missense probably benign 0.01
IGL02191:Dnah6 APN 6 73017797 missense probably benign 0.00
IGL02293:Dnah6 APN 6 73133650 splice site probably benign
IGL02316:Dnah6 APN 6 73168911 missense probably benign 0.19
IGL02339:Dnah6 APN 6 73101898 missense probably benign 0.00
IGL02380:Dnah6 APN 6 73076640 missense probably benign 0.12
IGL02458:Dnah6 APN 6 73027448 missense probably benign 0.43
IGL02499:Dnah6 APN 6 73021227 missense probably benign 0.12
IGL02652:Dnah6 APN 6 73095104 missense probably damaging 1.00
IGL02668:Dnah6 APN 6 73121823 missense possibly damaging 0.61
IGL02858:Dnah6 APN 6 73208599 missense probably benign 0.03
IGL02875:Dnah6 APN 6 73138715 missense probably damaging 0.99
IGL02878:Dnah6 APN 6 73032587 missense probably benign 0.01
IGL02989:Dnah6 APN 6 73069420 missense probably damaging 1.00
IGL03001:Dnah6 APN 6 73149140 missense probably benign 0.19
IGL03135:Dnah6 APN 6 73145004 missense probably benign 0.00
IGL03145:Dnah6 APN 6 73041054 missense probably damaging 1.00
IGL03202:Dnah6 APN 6 73144700 missense probably damaging 1.00
IGL03282:Dnah6 APN 6 73053647 splice site probably benign
IGL03286:Dnah6 APN 6 73083085 missense probably damaging 1.00
IGL03372:Dnah6 APN 6 73075850 missense probably benign 0.15
P0025:Dnah6 UTSW 6 73163504 missense probably benign 0.00
PIT4305001:Dnah6 UTSW 6 73065755 missense probably benign 0.03
PIT4466001:Dnah6 UTSW 6 73208641 missense probably benign 0.00
PIT4480001:Dnah6 UTSW 6 73101880 missense probably benign 0.00
PIT4515001:Dnah6 UTSW 6 73114582 missense probably damaging 1.00
PIT4651001:Dnah6 UTSW 6 73060260 missense probably benign 0.02
R0103:Dnah6 UTSW 6 73092172 missense probably damaging 1.00
R0103:Dnah6 UTSW 6 73092172 missense probably damaging 1.00
R0105:Dnah6 UTSW 6 73155279 missense probably damaging 0.99
R0105:Dnah6 UTSW 6 73155279 missense probably damaging 0.99
R0127:Dnah6 UTSW 6 73038734 splice site probably benign
R0164:Dnah6 UTSW 6 73188535 splice site probably benign
R0165:Dnah6 UTSW 6 73021323 missense probably benign 0.01
R0183:Dnah6 UTSW 6 73082923 missense probably damaging 1.00
R0200:Dnah6 UTSW 6 73069420 missense probably damaging 1.00
R0304:Dnah6 UTSW 6 73159115 missense probably damaging 1.00
R0324:Dnah6 UTSW 6 73173558 missense possibly damaging 0.86
R0335:Dnah6 UTSW 6 73069399 splice site probably benign
R0345:Dnah6 UTSW 6 73021257 missense probably benign 0.12
R0357:Dnah6 UTSW 6 73188359 missense probably benign
R0362:Dnah6 UTSW 6 73208609 missense probably benign 0.06
R0377:Dnah6 UTSW 6 73121992 missense possibly damaging 0.93
R0386:Dnah6 UTSW 6 73083124 missense probably damaging 0.99
R0547:Dnah6 UTSW 6 73044774 missense probably benign 0.15
R0639:Dnah6 UTSW 6 73022412 missense probably benign 0.02
R0673:Dnah6 UTSW 6 73123811 missense probably benign 0.01
R0690:Dnah6 UTSW 6 73129474 missense probably benign 0.01
R0708:Dnah6 UTSW 6 73212622 missense probably benign 0.05
R0711:Dnah6 UTSW 6 73087602 missense probably damaging 0.99
R0718:Dnah6 UTSW 6 73035293 missense possibly damaging 0.80
R0894:Dnah6 UTSW 6 73124757 missense probably benign 0.00
R0972:Dnah6 UTSW 6 73159193 missense possibly damaging 0.94
R1263:Dnah6 UTSW 6 73144965 missense probably damaging 0.99
R1298:Dnah6 UTSW 6 73159135 missense probably damaging 1.00
R1300:Dnah6 UTSW 6 73124709 missense probably benign 0.22
R1301:Dnah6 UTSW 6 73208545 critical splice donor site probably null
R1341:Dnah6 UTSW 6 73191619 missense probably benign 0.09
R1509:Dnah6 UTSW 6 73027442 missense probably damaging 1.00
R1519:Dnah6 UTSW 6 73049048 missense probably damaging 0.97
R1533:Dnah6 UTSW 6 73151553 missense probably benign
R1557:Dnah6 UTSW 6 73049131 nonsense probably null
R1591:Dnah6 UTSW 6 73076600 missense probably benign 0.01
R1602:Dnah6 UTSW 6 73067469 missense probably damaging 1.00
R1610:Dnah6 UTSW 6 73144963 missense probably benign 0.09
R1616:Dnah6 UTSW 6 73100112 missense probably benign 0.10
R1643:Dnah6 UTSW 6 73044752 missense possibly damaging 0.85
R1644:Dnah6 UTSW 6 73155296 missense probably benign 0.18
R1655:Dnah6 UTSW 6 73205732 missense possibly damaging 0.88
R1661:Dnah6 UTSW 6 73124778 missense probably benign 0.00
R1665:Dnah6 UTSW 6 73124778 missense probably benign 0.00
R1675:Dnah6 UTSW 6 73129540 missense probably damaging 1.00
R1734:Dnah6 UTSW 6 73044761 missense probably damaging 0.98
R1757:Dnah6 UTSW 6 73160982 missense probably damaging 1.00
R1794:Dnah6 UTSW 6 73024958 missense probably damaging 0.99
R1831:Dnah6 UTSW 6 73181797 missense possibly damaging 0.76
R1866:Dnah6 UTSW 6 73100088 missense probably benign 0.00
R1897:Dnah6 UTSW 6 73181762 missense probably benign 0.30
R1951:Dnah6 UTSW 6 73084721 nonsense probably null
R1978:Dnah6 UTSW 6 73121970 missense possibly damaging 0.51
R1987:Dnah6 UTSW 6 73095044 missense probably damaging 0.96
R1988:Dnah6 UTSW 6 73092192 missense probably damaging 1.00
R2012:Dnah6 UTSW 6 73067466 missense probably damaging 1.00
R2014:Dnah6 UTSW 6 73173419 missense probably damaging 0.98
R2022:Dnah6 UTSW 6 73027422 missense probably benign
R2041:Dnah6 UTSW 6 73073439 missense probably damaging 1.00
R2068:Dnah6 UTSW 6 73021182 missense probably benign 0.23
R2114:Dnah6 UTSW 6 73144035 missense probably damaging 1.00
R2152:Dnah6 UTSW 6 73049166 missense probably benign 0.32
R2163:Dnah6 UTSW 6 73089746 splice site probably null
R2193:Dnah6 UTSW 6 73138640 missense probably damaging 1.00
R2235:Dnah6 UTSW 6 73100085 missense probably damaging 0.96
R2276:Dnah6 UTSW 6 73113581 missense probably benign 0.15
R2292:Dnah6 UTSW 6 73021109 missense probably damaging 1.00
R2355:Dnah6 UTSW 6 73156421 missense possibly damaging 0.95
R2395:Dnah6 UTSW 6 73091967 splice site probably null
R2436:Dnah6 UTSW 6 73149173 missense probably benign 0.05
R2847:Dnah6 UTSW 6 73129331 missense probably benign 0.41
R2848:Dnah6 UTSW 6 73129331 missense probably benign 0.41
R3033:Dnah6 UTSW 6 73173350 missense probably benign 0.03
R3429:Dnah6 UTSW 6 73121814 missense possibly damaging 0.95
R3430:Dnah6 UTSW 6 73121814 missense possibly damaging 0.95
R3499:Dnah6 UTSW 6 73032633 missense probably benign 0.21
R3811:Dnah6 UTSW 6 73191498 missense probably benign 0.00
R3852:Dnah6 UTSW 6 73127927 missense possibly damaging 0.82
R3975:Dnah6 UTSW 6 73121992 missense possibly damaging 0.93
R4164:Dnah6 UTSW 6 73089592 nonsense probably null
R4246:Dnah6 UTSW 6 73129448 missense probably benign 0.00
R4367:Dnah6 UTSW 6 73149484 missense possibly damaging 0.95
R4378:Dnah6 UTSW 6 73118026 missense probably benign 0.01
R4405:Dnah6 UTSW 6 73129291 missense probably benign 0.00
R4420:Dnah6 UTSW 6 73191479 missense probably benign
R4486:Dnah6 UTSW 6 73038746 missense probably damaging 1.00
R4512:Dnah6 UTSW 6 73178416 missense probably damaging 1.00
R4547:Dnah6 UTSW 6 73192405 missense probably benign
R4573:Dnah6 UTSW 6 73086181 missense probably damaging 1.00
R4574:Dnah6 UTSW 6 73086181 missense probably damaging 1.00
R4590:Dnah6 UTSW 6 73152712 missense probably damaging 0.99
R4604:Dnah6 UTSW 6 73129660 missense possibly damaging 0.92
R4652:Dnah6 UTSW 6 73070597 missense probably benign
R4653:Dnah6 UTSW 6 73073457 missense possibly damaging 0.76
R4669:Dnah6 UTSW 6 73037688 missense probably damaging 1.00
R4674:Dnah6 UTSW 6 73192422 missense probably benign 0.04
R4712:Dnah6 UTSW 6 73025012 critical splice acceptor site probably null
R4788:Dnah6 UTSW 6 73129530 missense probably damaging 1.00
R4791:Dnah6 UTSW 6 73095074 missense probably benign 0.11
R4792:Dnah6 UTSW 6 73089668 missense probably damaging 0.99
R4801:Dnah6 UTSW 6 73089698 missense probably damaging 1.00
R4802:Dnah6 UTSW 6 73089698 missense probably damaging 1.00
R4817:Dnah6 UTSW 6 73022424 missense probably benign 0.02
R4830:Dnah6 UTSW 6 73044762 missense possibly damaging 0.85
R4862:Dnah6 UTSW 6 73121788 missense probably damaging 0.99
R4916:Dnah6 UTSW 6 73192676 intron probably benign
R4948:Dnah6 UTSW 6 73053689 missense probably benign 0.00
R4953:Dnah6 UTSW 6 73188383 missense probably benign 0.19
R5000:Dnah6 UTSW 6 73144815 missense probably benign 0.26
R5036:Dnah6 UTSW 6 73044691 missense probably benign
R5044:Dnah6 UTSW 6 73037622 missense probably benign 0.41
R5143:Dnah6 UTSW 6 73181761 missense possibly damaging 0.91
R5157:Dnah6 UTSW 6 73195634 missense probably benign
R5186:Dnah6 UTSW 6 73067427 missense probably damaging 1.00
R5201:Dnah6 UTSW 6 73195732 missense possibly damaging 0.82
R5249:Dnah6 UTSW 6 73113488 missense probably damaging 1.00
R5272:Dnah6 UTSW 6 73127861 critical splice donor site probably null
R5330:Dnah6 UTSW 6 73074590 missense probably damaging 1.00
R5331:Dnah6 UTSW 6 73074590 missense probably damaging 1.00
R5340:Dnah6 UTSW 6 73212620 missense probably benign
R5343:Dnah6 UTSW 6 73212616 missense probably benign
R5375:Dnah6 UTSW 6 73123855 missense probably damaging 1.00
R5380:Dnah6 UTSW 6 73037615 missense probably damaging 1.00
R5435:Dnah6 UTSW 6 73060138 missense probably benign 0.00
R5455:Dnah6 UTSW 6 73075734 missense probably benign 0.00
R5458:Dnah6 UTSW 6 73086185 missense probably damaging 1.00
R5463:Dnah6 UTSW 6 73092157 missense probably benign 0.04
R5484:Dnah6 UTSW 6 73092116 missense possibly damaging 0.95
R5513:Dnah6 UTSW 6 73190419 missense probably null 0.00
R5527:Dnah6 UTSW 6 73159229 missense probably benign
R5541:Dnah6 UTSW 6 73192988 missense possibly damaging 0.91
R5548:Dnah6 UTSW 6 73151689 missense probably damaging 1.00
R5680:Dnah6 UTSW 6 73149525 missense probably damaging 1.00
R5689:Dnah6 UTSW 6 73021227 missense probably benign 0.12
R5966:Dnah6 UTSW 6 73060279 missense probably benign 0.00
R5980:Dnah6 UTSW 6 73181722 missense probably benign 0.01
R6049:Dnah6 UTSW 6 73086166 missense probably benign 0.38
R6092:Dnah6 UTSW 6 73114697 missense possibly damaging 0.61
R6130:Dnah6 UTSW 6 73188494 missense probably benign 0.16
R6279:Dnah6 UTSW 6 73065815 missense probably damaging 1.00
R6300:Dnah6 UTSW 6 73065815 missense probably damaging 1.00
R6301:Dnah6 UTSW 6 73086217 missense probably damaging 1.00
R6315:Dnah6 UTSW 6 73191605 missense probably benign 0.02
R6394:Dnah6 UTSW 6 73155418 nonsense probably null
R6470:Dnah6 UTSW 6 73074586 missense probably damaging 1.00
R6526:Dnah6 UTSW 6 73074704 missense probably benign 0.05
R6545:Dnah6 UTSW 6 73044732 missense probably damaging 1.00
R6583:Dnah6 UTSW 6 73173533 missense probably benign 0.02
R6609:Dnah6 UTSW 6 73053695 missense possibly damaging 0.52
R6638:Dnah6 UTSW 6 73035280 splice site probably null
R6640:Dnah6 UTSW 6 73024293 missense probably damaging 1.00
R6647:Dnah6 UTSW 6 73138760 missense probably damaging 1.00
R6744:Dnah6 UTSW 6 73037549 missense probably damaging 0.97
R6767:Dnah6 UTSW 6 73133608 missense probably benign 0.29
R6845:Dnah6 UTSW 6 73133542 missense probably damaging 1.00
R6913:Dnah6 UTSW 6 73212522 missense probably benign 0.00
R6918:Dnah6 UTSW 6 73181755 nonsense probably null
R6929:Dnah6 UTSW 6 73044773 missense probably damaging 0.96
R6981:Dnah6 UTSW 6 73021178 missense probably benign 0.00
R7065:Dnah6 UTSW 6 73087562 missense possibly damaging 0.87
R7139:Dnah6 UTSW 6 73135680 missense probably damaging 1.00
R7169:Dnah6 UTSW 6 73038746 missense probably damaging 1.00
R7202:Dnah6 UTSW 6 73181705 critical splice donor site probably null
R7203:Dnah6 UTSW 6 73173545 missense probably benign 0.00
R7315:Dnah6 UTSW 6 73084760 missense probably damaging 1.00
R7329:Dnah6 UTSW 6 73144722 nonsense probably null
R7387:Dnah6 UTSW 6 73212612 nonsense probably null
R7388:Dnah6 UTSW 6 73192317 missense possibly damaging 0.47
R7454:Dnah6 UTSW 6 73212492 missense probably damaging 1.00
R7520:Dnah6 UTSW 6 73127904 missense probably benign 0.04
R7524:Dnah6 UTSW 6 73118099 missense probably damaging 1.00
R7548:Dnah6 UTSW 6 73027440 missense probably damaging 1.00
R7570:Dnah6 UTSW 6 73149430 missense probably benign 0.01
R7604:Dnah6 UTSW 6 73092168 missense probably damaging 1.00
R7615:Dnah6 UTSW 6 73095206 missense possibly damaging 0.85
R7622:Dnah6 UTSW 6 73124759 missense possibly damaging 0.94
R7690:Dnah6 UTSW 6 73169080 splice site probably null
R7735:Dnah6 UTSW 6 73069429 missense probably damaging 1.00
R7754:Dnah6 UTSW 6 73025720 missense probably benign 0.41
R7829:Dnah6 UTSW 6 73127919 nonsense probably null
R7904:Dnah6 UTSW 6 73135467 splice site probably null
R8034:Dnah6 UTSW 6 73129225 missense probably damaging 1.00
R8093:Dnah6 UTSW 6 73160913 missense probably damaging 1.00
R8120:Dnah6 UTSW 6 73025786 missense probably damaging 1.00
R8178:Dnah6 UTSW 6 73060225 missense probably benign 0.16
R8206:Dnah6 UTSW 6 73037566 nonsense probably null
R8214:Dnah6 UTSW 6 73044728 missense probably damaging 1.00
R8269:Dnah6 UTSW 6 73168827 critical splice donor site probably null
R8273:Dnah6 UTSW 6 73076599 missense probably benign 0.31
R8273:Dnah6 UTSW 6 73195681 missense probably benign 0.00
R8331:Dnah6 UTSW 6 73025000 missense probably benign 0.10
R8350:Dnah6 UTSW 6 73195815 missense probably benign 0.41
R8428:Dnah6 UTSW 6 73074651 missense probably benign 0.15
R8447:Dnah6 UTSW 6 73138774 missense probably damaging 0.99
R8450:Dnah6 UTSW 6 73195815 missense probably benign 0.41
R8517:Dnah6 UTSW 6 73178457 missense probably benign 0.16
R8523:Dnah6 UTSW 6 73095188 missense probably damaging 1.00
R8691:Dnah6 UTSW 6 73168867 missense probably damaging 1.00
R8700:Dnah6 UTSW 6 73075890 intron probably benign
R8737:Dnah6 UTSW 6 73067445 missense possibly damaging 0.83
R8762:Dnah6 UTSW 6 73179828 missense possibly damaging 0.83
R8804:Dnah6 UTSW 6 73065773 missense probably benign
R8809:Dnah6 UTSW 6 73032563 missense possibly damaging 0.94
R8813:Dnah6 UTSW 6 73127954 missense probably damaging 1.00
R8849:Dnah6 UTSW 6 73144173 critical splice acceptor site probably null
R8867:Dnah6 UTSW 6 73021148 missense probably damaging 1.00
R8882:Dnah6 UTSW 6 73178498 missense probably benign 0.05
R8973:Dnah6 UTSW 6 73144751 missense probably benign 0.39
R9049:Dnah6 UTSW 6 73142292 missense probably damaging 1.00
R9053:Dnah6 UTSW 6 73084657 missense possibly damaging 0.94
R9064:Dnah6 UTSW 6 73149173 missense probably benign 0.00
R9077:Dnah6 UTSW 6 73144046 nonsense probably null
R9102:Dnah6 UTSW 6 73067486 missense probably benign
R9106:Dnah6 UTSW 6 73144769 missense probably damaging 1.00
R9119:Dnah6 UTSW 6 73060203 missense possibly damaging 0.95
R9165:Dnah6 UTSW 6 73144941 missense probably damaging 1.00
R9182:Dnah6 UTSW 6 73144705 nonsense probably null
R9200:Dnah6 UTSW 6 73027514 missense probably benign 0.06
R9265:Dnah6 UTSW 6 73083057 missense probably benign 0.02
R9368:Dnah6 UTSW 6 73021278 missense probably benign 0.22
R9378:Dnah6 UTSW 6 73212530 missense probably benign
R9439:Dnah6 UTSW 6 73035347 missense possibly damaging 0.66
RF002:Dnah6 UTSW 6 73101889 missense probably benign
RF020:Dnah6 UTSW 6 73118057 missense probably benign 0.00
W0251:Dnah6 UTSW 6 73178518 missense possibly damaging 0.95
X0025:Dnah6 UTSW 6 73037673 missense probably damaging 1.00
X0025:Dnah6 UTSW 6 73191500 missense probably benign 0.01
Z1176:Dnah6 UTSW 6 73087783 missense possibly damaging 0.79
Z1176:Dnah6 UTSW 6 73133559 missense probably benign
Z1177:Dnah6 UTSW 6 73021237 missense probably benign 0.13
Z1177:Dnah6 UTSW 6 73032526 missense probably damaging 0.99
Z1177:Dnah6 UTSW 6 73041138 missense probably damaging 1.00
Z1177:Dnah6 UTSW 6 73155272 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- AAATCCCAGGGTCAGTGTGG -3'
(R):5'- TGAAATTCAACTCTGTGCCTTG -3'

Sequencing Primer
(F):5'- CCAGGGTCAGTGTGGATTCTGAAG -3'
(R):5'- CAACTCTGTGCCTTGGTTTTTAATG -3'
Posted On 2022-01-20