Incidental Mutation 'R9124:Dsp'
ID 693130
Institutional Source Beutler Lab
Gene Symbol Dsp
Ensembl Gene ENSMUSG00000054889
Gene Name desmoplakin
Synonyms 5730453H04Rik, DP, 2300002E22Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9124 (G1)
Quality Score 225.009
Status Not validated
Chromosome 13
Chromosomal Location 38151294-38198577 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 38193300 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Aspartic acid at position 1687 (V1687D)
Ref Sequence ENSEMBL: ENSMUSP00000115062 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000124830] [ENSMUST00000127906]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000124830
AA Change: V1687D

PolyPhen 2 Score 0.424 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000115062
Gene: ENSMUSG00000054889
AA Change: V1687D

DomainStartEndE-ValueType
Blast:SPEC 193 282 2e-51 BLAST
SPEC 285 385 6.03e-2 SMART
Blast:SPEC 391 557 1e-96 BLAST
Blast:SPEC 783 894 4e-34 BLAST
SPEC 901 1030 1.39e0 SMART
coiled coil region 1033 1370 N/A INTRINSIC
coiled coil region 1394 1956 N/A INTRINSIC
low complexity region 1997 2011 N/A INTRINSIC
PLEC 2021 2057 3.33e-1 SMART
PLEC 2058 2095 3.76e-9 SMART
PLEC 2096 2133 4.09e-10 SMART
PLEC 2134 2171 2.09e-7 SMART
PLEC 2175 2209 4.83e1 SMART
PLEC 2210 2245 5.67e1 SMART
PLEC 2263 2300 1.22e-8 SMART
PLEC 2301 2338 1.16e-9 SMART
PLEC 2339 2376 1.12e-7 SMART
PLEC 2377 2414 1.56e-6 SMART
PLEC 2418 2452 1.42e0 SMART
PLEC 2468 2505 3.7e-8 SMART
low complexity region 2507 2517 N/A INTRINSIC
PLEC 2519 2556 3.73e-4 SMART
low complexity region 2577 2593 N/A INTRINSIC
PLEC 2622 2659 1.46e-6 SMART
PLEC 2660 2697 6.69e-15 SMART
PLEC 2698 2735 1.98e2 SMART
PLEC 2736 2773 2.35e-10 SMART
PLEC 2774 2811 1.39e-3 SMART
low complexity region 2835 2860 N/A INTRINSIC
low complexity region 2867 2879 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127906
SMART Domains Protein: ENSMUSP00000117252
Gene: ENSMUSG00000054889

DomainStartEndE-ValueType
Blast:SPEC 193 282 2e-51 BLAST
SPEC 285 385 6.03e-2 SMART
Blast:SPEC 391 557 1e-95 BLAST
Blast:SPEC 783 894 3e-34 BLAST
SPEC 901 1030 1.39e0 SMART
coiled coil region 1033 1357 N/A INTRINSIC
low complexity region 1398 1412 N/A INTRINSIC
PLEC 1422 1458 3.33e-1 SMART
PLEC 1459 1496 3.76e-9 SMART
PLEC 1497 1534 4.09e-10 SMART
PLEC 1535 1572 2.09e-7 SMART
PLEC 1576 1610 4.83e1 SMART
PLEC 1611 1646 5.67e1 SMART
PLEC 1664 1701 1.22e-8 SMART
PLEC 1702 1739 1.16e-9 SMART
PLEC 1740 1777 1.12e-7 SMART
PLEC 1778 1815 1.56e-6 SMART
PLEC 1819 1853 1.42e0 SMART
PLEC 1869 1906 3.7e-8 SMART
low complexity region 1908 1918 N/A INTRINSIC
PLEC 1920 1957 3.73e-4 SMART
low complexity region 1978 1994 N/A INTRINSIC
PLEC 2023 2060 1.46e-6 SMART
PLEC 2061 2098 6.69e-15 SMART
PLEC 2099 2136 1.98e2 SMART
PLEC 2137 2174 2.35e-10 SMART
PLEC 2175 2212 1.39e-3 SMART
low complexity region 2236 2261 N/A INTRINSIC
low complexity region 2268 2280 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that anchors intermediate filaments to desmosomal plaques and forms an obligate component of functional desmosomes. Mutations in this gene are the cause of several cardiomyopathies and keratodermas, including skin fragility-woolly hair syndrome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016]
PHENOTYPE: Homozygous targeted null mutants die by embryonic day E6.5 due to instability of desmosomes and tissue integrity; rescue by aggregation with wild-type tetraploid morulae increase embyronic survival with noted major defects in heart muscle, neuroepithelium and epidermis; conditional knockouts that are epidermal-specific have compositionally altered epidermal desmosomes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1bg G T 15: 60,920,830 N89K possibly damaging Het
Abca5 A T 11: 110,298,179 D817E possibly damaging Het
Abca8b G A 11: 109,937,767 S1435F probably damaging Het
Akap9 T C 5: 4,061,284 L3115P probably damaging Het
Arhgap39 G A 15: 76,735,267 R706W probably damaging Het
BC048403 C T 10: 121,750,511 Q244* probably null Het
BC061237 A T 14: 44,503,394 I84F possibly damaging Het
Bhlhe22 T C 3: 18,055,178 S131P probably damaging Het
Brinp1 C A 4: 68,829,345 D174Y probably damaging Het
Bsdc1 A G 4: 129,465,275 T40A probably benign Het
Ccdc65 A T 15: 98,720,982 K281* probably null Het
Cd22 T C 7: 30,873,237 I316V probably benign Het
Cfap100 A C 6: 90,409,348 I275S Het
Chd3 T G 11: 69,369,336 E19A unknown Het
Chrnb1 T C 11: 69,794,231 D91G probably benign Het
Cr1l A G 1: 195,117,617 S250P possibly damaging Het
Csmd1 A G 8: 15,984,806 V2455A probably damaging Het
Dbp C T 7: 45,708,394 R229C probably damaging Het
Dmxl1 C G 18: 49,939,572 N2744K probably damaging Het
Dnah6 C A 6: 73,121,899 V2058F possibly damaging Het
Dtd1 T A 2: 144,603,878 M45K possibly damaging Het
Fat1 T A 8: 44,950,326 F38Y probably benign Het
Fat1 T A 8: 45,025,027 V2370E possibly damaging Het
Fgfr1 T A 8: 25,570,169 D438E probably damaging Het
Fsip2 A T 2: 82,985,759 K3945N probably benign Het
Galc C A 12: 98,254,164 probably null Het
Git1 C A 11: 77,504,672 D398E possibly damaging Het
Gm12569 T C 11: 51,234,654 S135P probably benign Het
Gm281 A G 14: 13,864,354 F324S Het
Gm4924 A G 10: 82,379,041 Q891R unknown Het
Gm5724 A G 6: 141,723,104 V534A possibly damaging Het
Gm765 T A 6: 98,341,938 N22I possibly damaging Het
Gm884 T C 11: 103,618,895 Y749C unknown Het
Havcr2 C T 11: 46,469,561 T205I probably benign Het
Herc2 A G 7: 56,184,308 N3087S probably damaging Het
Ifi204 C T 1: 173,751,627 probably null Het
Imp4 C T 1: 34,440,047 R4W unknown Het
Itfg2 A G 6: 128,424,807 S3P probably damaging Het
Kcnn3 C T 3: 89,521,229 T254I possibly damaging Het
Kpna1 A G 16: 36,033,274 I425V probably benign Het
Krt23 A T 11: 99,492,929 S46T probably damaging Het
Loxl4 C A 19: 42,607,660 W118L probably damaging Het
Lysmd2 T A 9: 75,625,793 L10Q probably damaging Het
Mctp2 T A 7: 72,259,430 D45V probably damaging Het
Mfsd10 T C 5: 34,634,596 T341A probably benign Het
Micu1 T A 10: 59,750,513 L170Q probably damaging Het
Muc5ac T C 7: 141,809,792 I2280T unknown Het
Myo15 A T 11: 60,479,126 Q904L probably benign Het
Myo6 G A 9: 80,288,071 D908N unknown Het
Nlrp4e A T 7: 23,320,978 M297L probably benign Het
Oas3 A C 5: 120,774,105 D73E probably damaging Het
Olfr213 A T 6: 116,540,455 M1L probably null Het
Olfr429 T C 1: 174,089,775 L245P probably damaging Het
Olfr536 T A 7: 140,504,309 H50L probably benign Het
Olfr619 A T 7: 103,603,656 M1L probably benign Het
Papd4 A T 13: 93,147,652 L465* probably null Het
Pck1 C G 2: 173,155,225 A220G probably benign Het
Pigq G A 17: 25,937,259 T65I probably damaging Het
Pld2 T C 11: 70,540,870 F9L probably damaging Het
Plk3 ACACTCAC ACAC 4: 117,131,893 probably benign Het
Pnkd A G 1: 74,347,443 R138G possibly damaging Het
Ralgapa1 A T 12: 55,735,096 I781N probably damaging Het
Ranbp2 A G 10: 58,492,897 I2873V probably benign Het
Rpn2 C A 2: 157,297,538 Q283K probably benign Het
Shmt2 A G 10: 127,519,692 S178P possibly damaging Het
Shroom3 A G 5: 92,964,542 K1921E probably benign Het
Slc20a1 A G 2: 129,209,222 S600G probably damaging Het
Slit1 C T 19: 41,606,512 V1140I probably benign Het
Sncg T C 14: 34,373,683 S51G possibly damaging Het
Spon2 C A 5: 33,215,591 D256Y possibly damaging Het
Srcap G T 7: 127,560,702 R3250L unknown Het
Sun1 T G 5: 139,245,366 Y763* probably null Het
Synj1 A T 16: 90,938,625 F1480Y probably benign Het
Tbc1d30 T A 10: 121,296,811 N216I probably damaging Het
Tmem87a A G 2: 120,394,360 probably null Het
Tmem8b C A 4: 43,681,982 R452S probably benign Het
Tnfsf13b A G 8: 10,006,966 I42V probably benign Het
Trpc2 A G 7: 102,095,883 T769A possibly damaging Het
Ttc3 A G 16: 94,435,530 T1033A probably benign Het
Ttll13 C T 7: 80,257,003 A473V probably damaging Het
U2surp G A 9: 95,464,415 R908* probably null Het
Ube2s A G 7: 4,811,511 Y17H probably damaging Het
Usmg5 T C 19: 47,086,139 M28V probably benign Het
Vmn1r94 A T 7: 20,167,584 M265K probably benign Het
Vmn2r23 T C 6: 123,742,079 I797T possibly damaging Het
Yipf3 A T 17: 46,248,969 E70D probably benign Het
Zcchc14 G A 8: 121,605,230 P465S unknown Het
Zfp169 T C 13: 48,491,081 E190G unknown Het
Zfp707 T C 15: 75,973,619 S111P Het
Zfp738 T C 13: 67,671,338 E178G possibly damaging Het
Zfr A T 15: 12,136,671 N138I unknown Het
Other mutations in Dsp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00502:Dsp APN 13 38197846 missense probably damaging 0.99
IGL01337:Dsp APN 13 38192687 missense probably benign 0.44
IGL01371:Dsp APN 13 38193617 missense probably benign 0.13
IGL01473:Dsp APN 13 38167571 missense probably damaging 0.99
IGL01660:Dsp APN 13 38176495 missense possibly damaging 0.90
IGL01723:Dsp APN 13 38179084 missense probably damaging 1.00
IGL01999:Dsp APN 13 38181186 missense probably damaging 0.99
IGL02313:Dsp APN 13 38196523 nonsense probably null
IGL02833:Dsp APN 13 38192921 missense possibly damaging 0.56
IGL03050:Dsp APN 13 38188445 splice site probably benign
IGL03353:Dsp APN 13 38186695 missense probably damaging 1.00
R0052:Dsp UTSW 13 38197364 missense possibly damaging 0.93
R0052:Dsp UTSW 13 38197364 missense possibly damaging 0.93
R0078:Dsp UTSW 13 38196017 missense probably benign 0.22
R0230:Dsp UTSW 13 38197705 missense probably benign 0.03
R0234:Dsp UTSW 13 38187893 missense probably benign 0.13
R0234:Dsp UTSW 13 38187893 missense probably benign 0.13
R0285:Dsp UTSW 13 38172794 missense probably benign
R0326:Dsp UTSW 13 38192870 nonsense probably null
R0332:Dsp UTSW 13 38182228 nonsense probably null
R0471:Dsp UTSW 13 38193350 nonsense probably null
R0567:Dsp UTSW 13 38192438 missense probably benign 0.01
R0611:Dsp UTSW 13 38187741 missense probably damaging 1.00
R0718:Dsp UTSW 13 38196764 missense possibly damaging 0.80
R0926:Dsp UTSW 13 38183218 missense probably damaging 0.97
R1078:Dsp UTSW 13 38183106 splice site probably benign
R1183:Dsp UTSW 13 38191740 nonsense probably null
R1188:Dsp UTSW 13 38194963 missense probably damaging 1.00
R1419:Dsp UTSW 13 38186695 missense probably damaging 1.00
R1445:Dsp UTSW 13 38191931 missense probably damaging 0.98
R1467:Dsp UTSW 13 38192712 missense probably benign 0.00
R1467:Dsp UTSW 13 38192712 missense probably benign 0.00
R1478:Dsp UTSW 13 38181138 missense probably damaging 1.00
R1568:Dsp UTSW 13 38175147 missense probably damaging 1.00
R1572:Dsp UTSW 13 38195738 missense probably damaging 1.00
R1676:Dsp UTSW 13 38193374 nonsense probably null
R1736:Dsp UTSW 13 38192990 missense probably benign 0.01
R1776:Dsp UTSW 13 38196617 missense probably damaging 0.99
R1829:Dsp UTSW 13 38193195 missense probably damaging 1.00
R1878:Dsp UTSW 13 38164855 missense possibly damaging 0.53
R2013:Dsp UTSW 13 38191458 missense probably damaging 1.00
R2161:Dsp UTSW 13 38196451 missense probably damaging 1.00
R2187:Dsp UTSW 13 38176407 missense probably damaging 1.00
R2295:Dsp UTSW 13 38197046 missense probably benign 0.28
R2495:Dsp UTSW 13 38193477 missense possibly damaging 0.91
R2566:Dsp UTSW 13 38196404 missense probably damaging 1.00
R2888:Dsp UTSW 13 38192248 missense possibly damaging 0.92
R3012:Dsp UTSW 13 38193342 missense possibly damaging 0.61
R3614:Dsp UTSW 13 38177199 missense probably damaging 0.98
R3725:Dsp UTSW 13 38194689 splice site probably null
R3725:Dsp UTSW 13 38197618 missense probably benign 0.00
R3797:Dsp UTSW 13 38177284 critical splice donor site probably null
R3841:Dsp UTSW 13 38197705 missense probably benign
R4030:Dsp UTSW 13 38191428 missense possibly damaging 0.84
R4124:Dsp UTSW 13 38186713 missense probably damaging 1.00
R4279:Dsp UTSW 13 38185231 missense probably damaging 1.00
R4334:Dsp UTSW 13 38196664 missense possibly damaging 0.46
R4419:Dsp UTSW 13 38195132 missense probably damaging 1.00
R4615:Dsp UTSW 13 38191632 missense probably damaging 0.98
R4627:Dsp UTSW 13 38168641 missense probably benign 0.01
R4639:Dsp UTSW 13 38196784 missense probably damaging 1.00
R4687:Dsp UTSW 13 38191619 missense probably damaging 1.00
R4735:Dsp UTSW 13 38196040 missense probably damaging 0.99
R4746:Dsp UTSW 13 38195104 missense possibly damaging 0.51
R4772:Dsp UTSW 13 38167528 nonsense probably null
R4830:Dsp UTSW 13 38192864 missense probably benign
R4850:Dsp UTSW 13 38192469 missense probably damaging 1.00
R4959:Dsp UTSW 13 38191710 missense probably benign 0.41
R4963:Dsp UTSW 13 38197870 missense probably damaging 0.99
R4969:Dsp UTSW 13 38192910 missense probably benign 0.00
R4978:Dsp UTSW 13 38182234 missense probably damaging 1.00
R4989:Dsp UTSW 13 38197702 missense possibly damaging 0.93
R5068:Dsp UTSW 13 38197123 missense possibly damaging 0.78
R5069:Dsp UTSW 13 38197123 missense possibly damaging 0.78
R5070:Dsp UTSW 13 38197123 missense possibly damaging 0.78
R5133:Dsp UTSW 13 38197702 missense possibly damaging 0.93
R5138:Dsp UTSW 13 38183298 missense probably benign 0.37
R5138:Dsp UTSW 13 38195845 missense possibly damaging 0.50
R5153:Dsp UTSW 13 38182306 missense probably damaging 1.00
R5199:Dsp UTSW 13 38192902 nonsense probably null
R5226:Dsp UTSW 13 38186770 missense probably damaging 0.99
R5265:Dsp UTSW 13 38195183 missense possibly damaging 0.95
R5371:Dsp UTSW 13 38194889 missense probably damaging 0.97
R5484:Dsp UTSW 13 38184038 missense possibly damaging 0.48
R5534:Dsp UTSW 13 38195842 missense probably benign 0.01
R5569:Dsp UTSW 13 38192652 missense probably benign 0.01
R5854:Dsp UTSW 13 38167501 splice site probably null
R5910:Dsp UTSW 13 38192469 missense possibly damaging 0.95
R5929:Dsp UTSW 13 38195434 missense possibly damaging 0.92
R5940:Dsp UTSW 13 38196026 missense possibly damaging 0.70
R5948:Dsp UTSW 13 38195401 missense possibly damaging 0.95
R5955:Dsp UTSW 13 38194958 missense possibly damaging 0.73
R5970:Dsp UTSW 13 38195702 missense possibly damaging 0.93
R6054:Dsp UTSW 13 38167609 missense probably benign 0.00
R6113:Dsp UTSW 13 38192047 missense probably damaging 1.00
R6139:Dsp UTSW 13 38192406 missense probably damaging 0.97
R6328:Dsp UTSW 13 38197006 nonsense probably null
R6527:Dsp UTSW 13 38195873 missense probably damaging 1.00
R6573:Dsp UTSW 13 38196862 missense probably damaging 1.00
R6628:Dsp UTSW 13 38167622 missense possibly damaging 0.73
R6738:Dsp UTSW 13 38192210 missense possibly damaging 0.87
R6898:Dsp UTSW 13 38192217 missense possibly damaging 0.59
R6919:Dsp UTSW 13 38167655 missense possibly damaging 0.84
R6951:Dsp UTSW 13 38167646 missense possibly damaging 0.95
R7017:Dsp UTSW 13 38186707 missense probably benign 0.02
R7022:Dsp UTSW 13 38191740 missense probably benign 0.06
R7135:Dsp UTSW 13 38179073 missense probably damaging 1.00
R7192:Dsp UTSW 13 38195593 missense probably benign 0.09
R7211:Dsp UTSW 13 38188535 critical splice donor site probably null
R7251:Dsp UTSW 13 38193548 missense probably benign 0.02
R7326:Dsp UTSW 13 38192883 missense probably benign 0.01
R7369:Dsp UTSW 13 38197525 missense possibly damaging 0.82
R7376:Dsp UTSW 13 38172843 missense probably damaging 1.00
R7406:Dsp UTSW 13 38197196 missense possibly damaging 0.63
R7439:Dsp UTSW 13 38176502 critical splice donor site probably null
R7439:Dsp UTSW 13 38195449 missense probably benign 0.00
R7441:Dsp UTSW 13 38195449 missense probably benign 0.00
R7477:Dsp UTSW 13 38172863 missense probably damaging 1.00
R7535:Dsp UTSW 13 38192789 missense probably benign 0.05
R7558:Dsp UTSW 13 38168766 missense probably benign 0.02
R7600:Dsp UTSW 13 38191715 missense probably damaging 1.00
R7616:Dsp UTSW 13 38191482 missense probably damaging 0.98
R7702:Dsp UTSW 13 38175207 missense possibly damaging 0.83
R7738:Dsp UTSW 13 38185175 missense probably damaging 0.97
R7815:Dsp UTSW 13 38191470 missense probably benign 0.31
R7882:Dsp UTSW 13 38184018 missense possibly damaging 0.76
R7917:Dsp UTSW 13 38167639 nonsense probably null
R7971:Dsp UTSW 13 38192523 missense probably damaging 0.97
R8104:Dsp UTSW 13 38168624 missense probably benign 0.03
R8176:Dsp UTSW 13 38192810 missense possibly damaging 0.56
R8303:Dsp UTSW 13 38197343 missense probably benign
R8323:Dsp UTSW 13 38172830 missense possibly damaging 0.80
R8326:Dsp UTSW 13 38191635 missense probably damaging 1.00
R8358:Dsp UTSW 13 38192481 missense possibly damaging 0.92
R8410:Dsp UTSW 13 38196815 missense possibly damaging 0.94
R8552:Dsp UTSW 13 38185141 missense probably damaging 0.98
R8713:Dsp UTSW 13 38168725 missense probably damaging 0.99
R8801:Dsp UTSW 13 38197526 missense possibly damaging 0.81
R8900:Dsp UTSW 13 38181179 missense probably damaging 0.99
R8901:Dsp UTSW 13 38181179 missense probably damaging 0.99
R8968:Dsp UTSW 13 38151620 missense possibly damaging 0.83
R9014:Dsp UTSW 13 38192724 missense possibly damaging 0.83
R9021:Dsp UTSW 13 38196832 missense possibly damaging 0.61
R9030:Dsp UTSW 13 38168697 missense probably damaging 1.00
R9129:Dsp UTSW 13 38193150 missense probably benign 0.09
R9143:Dsp UTSW 13 38193361 missense probably benign 0.05
X0023:Dsp UTSW 13 38197684 missense probably benign 0.00
X0024:Dsp UTSW 13 38193255 missense probably benign 0.04
X0027:Dsp UTSW 13 38186646 missense possibly damaging 0.68
X0067:Dsp UTSW 13 38182312 missense possibly damaging 0.85
Z1176:Dsp UTSW 13 38197190 missense possibly damaging 0.81
Z1177:Dsp UTSW 13 38151689 missense probably benign 0.01
Z1177:Dsp UTSW 13 38192854 frame shift probably null
Predicted Primers PCR Primer
(F):5'- AGGCCATGAGGAGGTCTTTG -3'
(R):5'- TGCTGATCTGCAGTTGGCTC -3'

Sequencing Primer
(F):5'- TCTTTGAAAGAGCAAGCCGTC -3'
(R):5'- ATCTGCAGTTGGCTCCTTAG -3'
Posted On 2022-01-20