Incidental Mutation 'R9124:Zfp169'
ID 693131
Institutional Source Beutler Lab
Gene Symbol Zfp169
Ensembl Gene ENSMUSG00000050954
Gene Name zinc finger protein 169
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock # R9124 (G1)
Quality Score 225.009
Status Validated
Chromosome 13
Chromosomal Location 48487647-48513451 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 48491081 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 190 (E190G)
Ref Sequence ENSEMBL: ENSMUSP00000135414 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110110] [ENSMUST00000167682] [ENSMUST00000176176] [ENSMUST00000176949] [ENSMUST00000176996] [ENSMUST00000177530]
AlphaFold E9Q3R6
Predicted Effect unknown
Transcript: ENSMUST00000110110
AA Change: E190G
SMART Domains Protein: ENSMUSP00000105737
Gene: ENSMUSG00000050954
AA Change: E190G

DomainStartEndE-ValueType
KRAB 14 74 9.74e-36 SMART
ZnF_C2H2 257 279 9.08e-4 SMART
ZnF_C2H2 285 308 2.2e-2 SMART
ZnF_C2H2 314 336 9.73e-4 SMART
ZnF_C2H2 342 364 2.86e-1 SMART
ZnF_C2H2 370 392 4.72e-2 SMART
ZnF_C2H2 398 420 4.24e-4 SMART
ZnF_C2H2 426 448 1.13e-4 SMART
ZnF_C2H2 454 476 2.2e-2 SMART
ZnF_C2H2 482 504 2.99e-4 SMART
ZnF_C2H2 510 532 2.57e-3 SMART
ZnF_C2H2 539 561 3.44e-4 SMART
ZnF_C2H2 567 589 3.69e-4 SMART
ZnF_C2H2 595 617 8.02e-5 SMART
ZnF_C2H2 623 645 1.26e-2 SMART
ZnF_C2H2 651 673 4.79e-3 SMART
ZnF_C2H2 679 701 1.3e-4 SMART
ZnF_C2H2 707 729 5.5e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167682
SMART Domains Protein: ENSMUSP00000127591
Gene: ENSMUSG00000050954

DomainStartEndE-ValueType
KRAB 14 74 9.74e-36 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176176
SMART Domains Protein: ENSMUSP00000134793
Gene: ENSMUSG00000050954

DomainStartEndE-ValueType
KRAB 14 74 9.74e-36 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176949
SMART Domains Protein: ENSMUSP00000135695
Gene: ENSMUSG00000050954

DomainStartEndE-ValueType
KRAB 14 74 9.74e-36 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176996
SMART Domains Protein: ENSMUSP00000135520
Gene: ENSMUSG00000050954

DomainStartEndE-ValueType
KRAB 14 74 9.74e-36 SMART
Predicted Effect unknown
Transcript: ENSMUST00000177530
AA Change: E190G
SMART Domains Protein: ENSMUSP00000135414
Gene: ENSMUSG00000050954
AA Change: E190G

DomainStartEndE-ValueType
KRAB 14 74 9.74e-36 SMART
ZnF_C2H2 257 279 9.08e-4 SMART
ZnF_C2H2 285 308 2.2e-2 SMART
ZnF_C2H2 314 336 9.73e-4 SMART
ZnF_C2H2 342 364 2.86e-1 SMART
ZnF_C2H2 370 392 4.72e-2 SMART
ZnF_C2H2 398 420 4.24e-4 SMART
ZnF_C2H2 426 448 1.13e-4 SMART
ZnF_C2H2 454 476 2.2e-2 SMART
ZnF_C2H2 482 504 2.99e-4 SMART
ZnF_C2H2 510 532 2.57e-3 SMART
ZnF_C2H2 539 561 3.44e-4 SMART
ZnF_C2H2 567 589 3.69e-4 SMART
ZnF_C2H2 595 617 8.02e-5 SMART
ZnF_C2H2 623 645 1.26e-2 SMART
ZnF_C2H2 651 673 4.79e-3 SMART
ZnF_C2H2 679 701 1.3e-4 SMART
ZnF_C2H2 707 729 5.5e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (91/91)
MGI Phenotype PHENOTYPE: Homozygous disruption of this locus does not result in an overt phenotype early in life. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1bg G T 15: 60,920,830 N89K possibly damaging Het
Abca5 A T 11: 110,298,179 D817E possibly damaging Het
Abca8b G A 11: 109,937,767 S1435F probably damaging Het
Akap9 T C 5: 4,061,284 L3115P probably damaging Het
Arhgap39 G A 15: 76,735,267 R706W probably damaging Het
BC048403 C T 10: 121,750,511 Q244* probably null Het
BC061237 A T 14: 44,503,394 I84F possibly damaging Het
Bhlhe22 T C 3: 18,055,178 S131P probably damaging Het
Brinp1 C A 4: 68,829,345 D174Y probably damaging Het
Bsdc1 A G 4: 129,465,275 T40A probably benign Het
Ccdc65 A T 15: 98,720,982 K281* probably null Het
Cd22 T C 7: 30,873,237 I316V probably benign Het
Cfap100 A C 6: 90,409,348 I275S Het
Chd3 T G 11: 69,369,336 E19A unknown Het
Chrnb1 T C 11: 69,794,231 D91G probably benign Het
Cr1l A G 1: 195,117,617 S250P possibly damaging Het
Csmd1 A G 8: 15,984,806 V2455A probably damaging Het
Dbp C T 7: 45,708,394 R229C probably damaging Het
Dmxl1 C G 18: 49,939,572 N2744K probably damaging Het
Dnah6 C A 6: 73,121,899 V2058F possibly damaging Het
Dsp T A 13: 38,193,300 V1687D probably benign Het
Dtd1 T A 2: 144,603,878 M45K possibly damaging Het
Fat1 T A 8: 44,950,326 F38Y probably benign Het
Fat1 T A 8: 45,025,027 V2370E possibly damaging Het
Fgfr1 T A 8: 25,570,169 D438E probably damaging Het
Fsip2 A T 2: 82,985,759 K3945N probably benign Het
Galc C A 12: 98,254,164 probably null Het
Git1 C A 11: 77,504,672 D398E possibly damaging Het
Gm12569 T C 11: 51,234,654 S135P probably benign Het
Gm281 A G 14: 13,864,354 F324S Het
Gm4924 A G 10: 82,379,041 Q891R unknown Het
Gm5724 A G 6: 141,723,104 V534A possibly damaging Het
Gm765 T A 6: 98,341,938 N22I possibly damaging Het
Gm884 T C 11: 103,618,895 Y749C unknown Het
Gpc2 T C 5: 138,276,522 probably benign Het
Havcr2 C T 11: 46,469,561 T205I probably benign Het
Herc2 A G 7: 56,184,308 N3087S probably damaging Het
Ifi204 C T 1: 173,751,627 probably null Het
Imp4 C T 1: 34,440,047 R4W unknown Het
Itfg2 A G 6: 128,424,807 S3P probably damaging Het
Kcnn3 C T 3: 89,521,229 T254I possibly damaging Het
Kpna1 A G 16: 36,033,274 I425V probably benign Het
Krt23 A T 11: 99,492,929 S46T probably damaging Het
Loxl4 C A 19: 42,607,660 W118L probably damaging Het
Lysmd2 T A 9: 75,625,793 L10Q probably damaging Het
Mcm5 T A 8: 75,124,790 probably benign Het
Mctp2 T A 7: 72,259,430 D45V probably damaging Het
Mfsd10 T C 5: 34,634,596 T341A probably benign Het
Micu1 T A 10: 59,750,513 L170Q probably damaging Het
Muc5ac T C 7: 141,809,792 I2280T unknown Het
Myo15 A T 11: 60,479,126 Q904L probably benign Het
Myo6 G A 9: 80,288,071 D908N unknown Het
Nlrp4e A T 7: 23,320,978 M297L probably benign Het
Nptn A G 9: 58,651,215 probably benign Het
Oas3 A C 5: 120,774,105 D73E probably damaging Het
Olfr213 A T 6: 116,540,455 M1L probably null Het
Olfr429 T C 1: 174,089,775 L245P probably damaging Het
Olfr536 T A 7: 140,504,309 H50L probably benign Het
Olfr619 A T 7: 103,603,656 M1L probably benign Het
Papd4 A T 13: 93,147,652 L465* probably null Het
Pck1 C G 2: 173,155,225 A220G probably benign Het
Pigq G A 17: 25,937,259 T65I probably damaging Het
Pld2 T C 11: 70,540,870 F9L probably damaging Het
Plk3 ACACTCAC ACAC 4: 117,131,893 probably benign Het
Pnkd A G 1: 74,347,443 R138G possibly damaging Het
Ralgapa1 A T 12: 55,735,096 I781N probably damaging Het
Ranbp2 A G 10: 58,492,897 I2873V probably benign Het
Rpn2 C A 2: 157,297,538 Q283K probably benign Het
Shmt2 A G 10: 127,519,692 S178P possibly damaging Het
Shroom3 A G 5: 92,964,542 K1921E probably benign Het
Slc20a1 A G 2: 129,209,222 S600G probably damaging Het
Slit1 C T 19: 41,606,512 V1140I probably benign Het
Sncg T C 14: 34,373,683 S51G possibly damaging Het
Spon2 C A 5: 33,215,591 D256Y possibly damaging Het
Srcap G T 7: 127,560,702 R3250L unknown Het
Sun1 T G 5: 139,245,366 Y763* probably null Het
Synj1 A T 16: 90,938,625 F1480Y probably benign Het
Tbc1d30 T A 10: 121,296,811 N216I probably damaging Het
Tgfb1 A T 7: 25,689,155 K39* probably null Het
Tmem87a A G 2: 120,394,360 probably null Het
Tmem8b C A 4: 43,681,982 R452S probably benign Het
Tnfsf13b A G 8: 10,006,966 I42V probably benign Het
Trpc2 A G 7: 102,095,883 T769A possibly damaging Het
Ttc3 A G 16: 94,435,530 T1033A probably benign Het
Ttll13 C T 7: 80,257,003 A473V probably damaging Het
U2surp G A 9: 95,464,415 R908* probably null Het
Ube2s A G 7: 4,811,511 Y17H probably damaging Het
Usmg5 T C 19: 47,086,139 M28V probably benign Het
Vmn1r94 A T 7: 20,167,584 M265K probably benign Het
Vmn2r23 T C 6: 123,742,079 I797T possibly damaging Het
Yipf3 A T 17: 46,248,969 E70D probably benign Het
Zcchc14 G A 8: 121,605,230 P465S unknown Het
Zfp707 T C 15: 75,973,619 S111P Het
Zfp738 T C 13: 67,671,338 E178G possibly damaging Het
Zfr A T 15: 12,136,671 N138I unknown Het
Other mutations in Zfp169
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01925:Zfp169 APN 13 48490763 unclassified probably benign
IGL03329:Zfp169 APN 13 48490794 unclassified probably benign
IGL03382:Zfp169 APN 13 48491163 unclassified probably benign
IGL03394:Zfp169 APN 13 48489924 missense possibly damaging 0.93
BB010:Zfp169 UTSW 13 48490481 missense unknown
BB020:Zfp169 UTSW 13 48490481 missense unknown
R0571:Zfp169 UTSW 13 48489690 missense possibly damaging 0.71
R1714:Zfp169 UTSW 13 48498854 missense probably benign 0.35
R1784:Zfp169 UTSW 13 48489819 missense possibly damaging 0.61
R3108:Zfp169 UTSW 13 48489996 missense possibly damaging 0.86
R3689:Zfp169 UTSW 13 48506901 splice site probably benign
R4444:Zfp169 UTSW 13 48490337 missense possibly damaging 0.94
R4665:Zfp169 UTSW 13 48490863 unclassified probably benign
R4719:Zfp169 UTSW 13 48490158 missense probably benign 0.06
R4745:Zfp169 UTSW 13 48490232 missense possibly damaging 0.71
R5288:Zfp169 UTSW 13 48490275 missense possibly damaging 0.61
R5384:Zfp169 UTSW 13 48490275 missense possibly damaging 0.61
R5979:Zfp169 UTSW 13 48491040 unclassified probably benign
R6053:Zfp169 UTSW 13 48498858 missense probably damaging 1.00
R6823:Zfp169 UTSW 13 48490996 unclassified probably benign
R7084:Zfp169 UTSW 13 48498863 missense probably benign 0.10
R7679:Zfp169 UTSW 13 48498383 missense probably damaging 0.99
R7933:Zfp169 UTSW 13 48490481 missense unknown
R8298:Zfp169 UTSW 13 48498377 nonsense probably null
R8322:Zfp169 UTSW 13 48491099 missense unknown
R9047:Zfp169 UTSW 13 48498816 missense probably damaging 1.00
R9126:Zfp169 UTSW 13 48491081 missense unknown
R9131:Zfp169 UTSW 13 48491081 missense unknown
R9132:Zfp169 UTSW 13 48491081 missense unknown
Predicted Primers PCR Primer
(F):5'- TCCGAACACGAGTAAGGCTTC -3'
(R):5'- ACTTCCAGTCAGAAGCTCCAGG -3'

Sequencing Primer
(F):5'- GAGTAAGGCTTCTCCACTCCG -3'
(R):5'- GCTCCAGGCTGTTCCAG -3'
Posted On 2022-01-20