Incidental Mutation 'R9125:Muc3a'
ID 693178
Institutional Source Beutler Lab
Gene Symbol Muc3a
Ensembl Gene ENSMUSG00000094840
Gene Name mucin 3A, cell surface associated
Synonyms A630081J09Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9125 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 137208813-137212389 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 137210753 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 115 (L115P)
Ref Sequence ENSEMBL: ENSMUSP00000136061 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000179412]
AlphaFold Q3U5A2
Predicted Effect probably damaging
Transcript: ENSMUST00000179412
AA Change: L115P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000136061
Gene: ENSMUSG00000094840
AA Change: L115P

DomainStartEndE-ValueType
Blast:EGF_like 54 95 1e-22 BLAST
transmembrane domain 103 125 N/A INTRINSIC
low complexity region 198 218 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000196391
AA Change: L113P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The mucin genes encode epithelial glycoproteins, some of which are secreted and some membrane bound. Each of the genes contains at least one large domain of tandemly repeated sequence that encodes the peptide sequence rich in serine and/or threonine residues, which carries most of the O-linked glycosylation (Gendler and Spicer, 1995 [PubMed 7778880]).[supplied by OMIM, Aug 2008]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110008L16Rik A T 12: 55,308,826 D372V possibly damaging Het
Abcg5 G A 17: 84,668,997 H471Y probably damaging Het
Adam3 A G 8: 24,723,501 L61P probably damaging Het
Ank2 T A 3: 126,940,095 D622V probably damaging Het
Antxr2 G A 5: 98,004,114 S166F probably damaging Het
Asph C T 4: 9,474,928 G682D possibly damaging Het
Asz1 T C 6: 18,054,562 E414G probably benign Het
B020004J07Rik A G 4: 101,836,876 V270A probably benign Het
BC067074 C T 13: 113,368,840 P2168S Het
Cabp2 G A 19: 4,085,597 D96N probably damaging Het
Cc2d2a T A 5: 43,703,221 D546E probably benign Het
Cdca2 T A 14: 67,680,313 R545S probably benign Het
Chrna7 G A 7: 63,107,609 Q181* probably null Het
Cib1 T C 7: 80,228,003 D182G probably damaging Het
Cib4 T C 5: 30,498,133 H76R probably benign Het
Clstn1 AGAGGAGGAGGAGGAGGAGGAG AGAGGAGGAGGAGGAGGAG 4: 149,647,408 probably benign Het
Cop1 T G 1: 159,239,617 F157V probably damaging Het
Dap3 T A 3: 88,930,554 T130S probably benign Het
Ddb2 T A 2: 91,234,248 K106* probably null Het
Derl3 G A 10: 75,894,609 V169I probably benign Het
Dusp6 T A 10: 99,266,212 C353* probably null Het
Fry A G 5: 150,346,060 N217S probably damaging Het
Gabrb2 A G 11: 42,591,866 T184A probably damaging Het
Gfpt1 G A 6: 87,076,266 V403I probably benign Het
Gm11639 A T 11: 104,845,534 D2110V probably damaging Het
Gm14548 T A 7: 3,897,022 I194L possibly damaging Het
Gm21671 T C 5: 25,951,598 M128V possibly damaging Het
Gm7276 A G 18: 77,185,451 S196P unknown Het
Grik1 T A 16: 88,056,068 T76S Het
Hrnr A G 3: 93,331,556 N3034D unknown Het
Kmt2c T C 5: 25,284,196 T4582A possibly damaging Het
Mroh9 T C 1: 163,047,843 I496V probably benign Het
Nfe2 A G 15: 103,249,444 L40P probably damaging Het
Nipsnap3b A T 4: 53,021,177 D216V probably damaging Het
Olfr1162 C T 2: 88,049,950 V225M probably damaging Het
Olfr913 T A 9: 38,594,812 I197K probably damaging Het
Otx1 G A 11: 21,999,458 Q7* probably null Het
Piezo2 A G 18: 63,045,518 I1776T probably benign Het
Ppp1r37 T C 7: 19,535,089 D162G probably benign Het
Ppp4c T A 7: 126,787,567 E116V probably damaging Het
Psme2 T A 14: 55,590,845 K15N possibly damaging Het
Retreg1 C T 15: 25,968,532 R125C probably damaging Het
Rgs16 A G 1: 153,742,128 E128G probably null Het
Rnf145 G T 11: 44,559,992 R381L probably damaging Het
Rnf2 T C 1: 151,471,682 K289E probably benign Het
Rsf1 CG CGACGGCGGGG 7: 97,579,908 probably benign Het
Ryr2 A G 13: 11,654,406 V3504A probably benign Het
Selp T A 1: 164,123,787 I30N probably benign Het
Serpinb5 C T 1: 106,870,407 A42V probably benign Het
Sfpq G A 4: 127,021,840 G142S unknown Het
Sh2d1b2 T C 1: 170,248,182 Y62H possibly damaging Het
Sipa1l3 C T 7: 29,387,231 E645K probably damaging Het
Slc22a1 T A 17: 12,659,711 T372S probably benign Het
Smarca2 T A 19: 26,716,183 D1262E possibly damaging Het
Sptbn2 A T 19: 4,734,213 Q661L probably benign Het
Tarbp1 G T 8: 126,447,463 T868K possibly damaging Het
Tnfrsf8 A G 4: 145,296,961 S101P probably damaging Het
Tsc2 C T 17: 24,604,828 R1001K probably null Het
Unc80 T A 1: 66,679,581 S2988T probably benign Het
Vmn1r195 A G 13: 22,279,165 I268M possibly damaging Het
Vmn1r27 G A 6: 58,215,431 T196I probably benign Het
Vmn2r80 T A 10: 79,148,926 D37E probably benign Het
Vmn2r9 A T 5: 108,848,181 H200Q Het
Washc5 T C 15: 59,337,285 Y1030C probably damaging Het
Wdr47 T C 3: 108,618,790 F210L probably damaging Het
Wscd2 C A 5: 113,577,356 A419E probably benign Het
Other mutations in Muc3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1500:Muc3a UTSW 5 137210501 splice site probably benign
R1536:Muc3a UTSW 5 137210081 missense unknown
R5076:Muc3a UTSW 5 137210540 missense probably damaging 0.99
R5356:Muc3a UTSW 5 137210564 missense probably benign 0.33
R6134:Muc3a UTSW 5 137210122 missense probably damaging 0.99
R6491:Muc3a UTSW 5 137212128 missense probably benign 0.00
R7524:Muc3a UTSW 5 137210563 missense probably benign 0.08
R8181:Muc3a UTSW 5 137210078 missense unknown
Predicted Primers PCR Primer
(F):5'- AAACCATTTCCTGTCCTGGG -3'
(R):5'- GACCAAACTCTCCAAGGTCCTG -3'

Sequencing Primer
(F):5'- ATTTCCTGTCCTGGGTCCAG -3'
(R):5'- CTGGCCACTTGCTCTAGGATG -3'
Posted On 2022-01-20