Incidental Mutation 'R9126:Ulk4'
ID 693260
Institutional Source Beutler Lab
Gene Symbol Ulk4
Ensembl Gene ENSMUSG00000040936
Gene Name unc-51-like kinase 4
Synonyms 4932415A06Rik
Accession Numbers

Genbank: NM_177589; MGI: 1921622

Is this an essential gene? Possibly non essential (E-score: 0.481) question?
Stock # R9126 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 120955351-121277197 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 121261922 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Proline to Glutamine at position 238 (P238Q)
Ref Sequence ENSEMBL: ENSMUSP00000057960 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051479] [ENSMUST00000051565] [ENSMUST00000170237] [ENSMUST00000171061] [ENSMUST00000171923]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000051479
AA Change: P238Q

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000057960
Gene: ENSMUSG00000040936
AA Change: P238Q

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 4 277 9.9e-26 PFAM
Pfam:Pkinase 4 280 4.6e-49 PFAM
low complexity region 949 964 N/A INTRINSIC
low complexity region 968 985 N/A INTRINSIC
low complexity region 1107 1119 N/A INTRINSIC
low complexity region 1147 1161 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000051565
SMART Domains Protein: ENSMUSP00000054833
Gene: ENSMUSG00000040936

DomainStartEndE-ValueType
SCOP:d1jvpp_ 1 32 9e-6 SMART
Blast:S_TKc 4 45 2e-8 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000170237
Predicted Effect probably damaging
Transcript: ENSMUST00000171061
AA Change: P238Q

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000129214
Gene: ENSMUSG00000040936
AA Change: P238Q

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 4 277 4.3e-26 PFAM
Pfam:Pkinase 4 280 2.1e-49 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000171923
AA Change: P238Q

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000131342
Gene: ENSMUSG00000040936
AA Change: P238Q

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 4 153 3.1e-14 PFAM
Pfam:Pkinase 4 280 4.9e-50 PFAM
Pfam:Pkinase_Tyr 165 277 6.1e-10 PFAM
low complexity region 949 964 N/A INTRINSIC
low complexity region 968 985 N/A INTRINSIC
low complexity region 1107 1119 N/A INTRINSIC
low complexity region 1147 1171 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the unc-51-like serine/threonine kinase (STK) family. Members of this protein family play a role in neuronal growth and endocytosis. The encoded protein is likely involved in neurite branching, neurite elongation and neuronal migration. Genome-wide association studies (GWAS) indicate an association of variations in this gene with blood pressure and hypertension. Sequence variations in this gene may also be be associated with psychiatric disorders, including schizophrenia and bipolar disorder. Pseudogenes associated with this gene have been identified and are located on chromosome 15. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygotes for a null allele show reduced body size, hydrocephaly, dilated brain ventricles, otitis media, and premature death. Hypomorphic mice show partial corpus callosum aplasia, hydrocephaly, subcommissural organ and ependymal motile ciliary defects, aqueduct stenosis, and impaired CSF flow. [provided by MGI curators]
Allele List at MGI

All alleles(2) : Targeted, other(1) Gene trapped(1)

Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610009O20Rik A G 18: 38,251,157 T35A probably benign Het
Adam30 G T 3: 98,160,991 V47L probably benign Het
Atm T C 9: 53,458,834 K2323R probably benign Het
Bbx A G 16: 50,200,450 L865P probably damaging Het
C2cd3 T A 7: 100,432,223 I1024N Het
Cacna1e A T 1: 154,467,764 C1161S probably benign Het
Caskin2 A T 11: 115,811,904 V26E possibly damaging Het
Ccnb3 T G X: 7,008,174 D722A probably damaging Het
Cep135 C A 5: 76,633,703 Q846K probably benign Het
Cfap44 A T 16: 44,475,256 D1639V possibly damaging Het
Cfh G T 1: 140,086,373 R1238S probably damaging Het
Dctn1 A T 6: 83,192,853 D712V probably damaging Het
Ddx21 T C 10: 62,588,700 D574G probably damaging Het
Dlgap5 A G 14: 47,401,532 I443T probably damaging Het
Dusp7 G A 9: 106,373,767 V364I Het
Entpd1 G T 19: 40,726,164 R268L possibly damaging Het
Fam69b A G 2: 26,635,977 T308A probably benign Het
Fermt3 C T 19: 7,002,377 A463T probably benign Het
Frat2 T C 19: 41,847,667 D82G probably damaging Het
Git1 T A 11: 77,499,554 I75N probably damaging Het
Gpr171 T A 3: 59,098,067 I96F probably damaging Het
Gzmb G T 14: 56,260,388 R132S probably benign Het
Hecw1 C T 13: 14,372,023 R132H probably damaging Het
Hey1 T G 3: 8,664,591 S269R probably benign Het
Hgf T A 5: 16,560,981 N38K possibly damaging Het
Lag3 T C 6: 124,904,846 R467G probably damaging Het
Lama3 A T 18: 12,450,470 H705L probably damaging Het
Lce3f T G 3: 92,993,020 S49R unknown Het
Lrrc49 T C 9: 60,671,311 D250G probably damaging Het
Lzts3 T C 2: 130,635,328 K400R possibly damaging Het
Macc1 T C 12: 119,445,976 S160P probably benign Het
Macf1 T C 4: 123,382,400 T6155A possibly damaging Het
Mboat4 C T 8: 34,115,194 T34I probably benign Het
Nav3 T A 10: 109,705,663 Q1913L probably benign Het
Notch4 T C 17: 34,581,106 S1014P probably benign Het
Olfr67 T G 7: 103,787,795 I161L probably benign Het
Olfr93 T C 17: 37,151,232 T247A possibly damaging Het
Olfr99 T C 17: 37,279,854 T189A probably benign Het
Orc2 A C 1: 58,476,469 H293Q probably benign Het
Otoa A G 7: 121,094,622 Y75C probably damaging Het
Pate2 T A 9: 35,670,612 probably null Het
Phldb3 G A 7: 24,627,301 V585I probably damaging Het
Plk3 ACACTCAC ACAC 4: 117,131,893 probably benign Het
Pou2f1 A T 1: 165,895,034 N443K unknown Het
Prkci T A 3: 31,018,644 F66I probably damaging Het
Ptprz1 C T 6: 23,002,335 Q1475* probably null Het
Qars C T 9: 108,509,200 R143C probably damaging Het
Reln T C 5: 21,955,196 D2125G probably damaging Het
Rp1 A T 1: 4,346,913 D1325E probably damaging Het
Rpl36a-ps1 A T 14: 98,994,258 C15S probably damaging Het
Rsf1 CG CGACGGCGGGG 7: 97,579,908 probably benign Het
Scn9a A G 2: 66,484,400 I1658T probably damaging Het
Serinc1 C T 10: 57,519,481 G370S probably benign Het
Spef1 G T 2: 131,171,909 T197K probably damaging Het
Sptan1 G A 2: 30,030,585 V2363I probably damaging Het
Ssh2 T A 11: 77,455,276 C1362* probably null Het
Star T C 8: 25,812,804 V258A probably benign Het
Sympk T C 7: 19,044,948 I588T possibly damaging Het
Tas2r136 T C 6: 132,777,621 N181S probably damaging Het
Tbc1d4 A T 14: 101,487,516 V555E probably benign Het
Thegl A G 5: 77,016,606 Y152C probably damaging Het
Topaz1 G A 9: 122,796,163 V1438I probably benign Het
Trmt112 T A 19: 6,910,418 M45K Het
Tshr G A 12: 91,537,218 R310H probably damaging Het
Unc5a T C 13: 54,997,961 L312P possibly damaging Het
Urb1 T C 16: 90,769,402 D1499G possibly damaging Het
Ushbp1 A G 8: 71,391,009 S262P probably damaging Het
Vmn1r173 G A 7: 23,702,583 R81K probably benign Het
Vmn2r5 G A 3: 64,491,738 P607S probably benign Het
Vtn G T 11: 78,500,430 G223V probably damaging Het
Zfhx4 T C 3: 5,329,529 V1061A probably damaging Het
Zfp169 T C 13: 48,491,081 E190G unknown Het
Zfp616 T A 11: 74,085,454 C850S probably damaging Het
Other mutations in Ulk4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01122:Ulk4 APN 9 121168292 missense possibly damaging 0.48
IGL01345:Ulk4 APN 9 121208162 missense possibly damaging 0.48
IGL01432:Ulk4 APN 9 121266301 missense probably damaging 1.00
IGL01807:Ulk4 APN 9 121255185 missense probably damaging 1.00
IGL02139:Ulk4 APN 9 121141831 splice site probably null
IGL02266:Ulk4 APN 9 121081700 missense probably benign 0.10
IGL02511:Ulk4 APN 9 121188354 missense probably damaging 1.00
IGL02546:Ulk4 APN 9 121152307 nonsense probably null
IGL02687:Ulk4 APN 9 121192662 missense possibly damaging 0.89
IGL03220:Ulk4 APN 9 121145336 missense probably damaging 1.00
3-1:Ulk4 UTSW 9 121255171 missense probably benign 0.02
R0031:Ulk4 UTSW 9 121272982 missense probably damaging 1.00
R0433:Ulk4 UTSW 9 121044819 missense probably benign 0.27
R0513:Ulk4 UTSW 9 121152325 missense probably benign 0.13
R0524:Ulk4 UTSW 9 121252651 critical splice donor site probably null
R1268:Ulk4 UTSW 9 121257074 splice site probably benign
R1439:Ulk4 UTSW 9 121266258 missense possibly damaging 0.58
R1470:Ulk4 UTSW 9 121081656 missense probably benign 0.00
R1470:Ulk4 UTSW 9 121081656 missense probably benign 0.00
R1531:Ulk4 UTSW 9 121044775 missense probably damaging 0.97
R1595:Ulk4 UTSW 9 121044838 missense probably damaging 0.96
R1620:Ulk4 UTSW 9 121204805 missense possibly damaging 0.81
R1835:Ulk4 UTSW 9 121168184 missense probably null 1.00
R1966:Ulk4 UTSW 9 121257116 missense probably benign
R2129:Ulk4 UTSW 9 121152182 missense probably benign 0.03
R2329:Ulk4 UTSW 9 121272887 missense probably damaging 1.00
R2877:Ulk4 UTSW 9 121260039 missense probably benign 0.11
R2878:Ulk4 UTSW 9 121260039 missense probably benign 0.11
R3734:Ulk4 UTSW 9 121261989 missense probably benign 0.21
R3769:Ulk4 UTSW 9 121263700 missense probably benign 0.00
R4005:Ulk4 UTSW 9 121168199 missense possibly damaging 0.94
R4024:Ulk4 UTSW 9 121044849 missense possibly damaging 0.86
R4321:Ulk4 UTSW 9 121073996 missense probably benign 0.00
R4461:Ulk4 UTSW 9 121156884 missense possibly damaging 0.83
R4537:Ulk4 UTSW 9 121263638 nonsense probably null
R4542:Ulk4 UTSW 9 121263638 nonsense probably null
R4572:Ulk4 UTSW 9 121192764 missense probably damaging 1.00
R4647:Ulk4 UTSW 9 121141852 missense probably benign 0.15
R4712:Ulk4 UTSW 9 121244370 missense probably benign 0.23
R4730:Ulk4 UTSW 9 121263725 missense probably benign 0.05
R4731:Ulk4 UTSW 9 121263638 nonsense probably null
R4732:Ulk4 UTSW 9 121263638 nonsense probably null
R4733:Ulk4 UTSW 9 121263638 nonsense probably null
R4737:Ulk4 UTSW 9 121073872 nonsense probably null
R4781:Ulk4 UTSW 9 121103576 missense probably benign 0.00
R4860:Ulk4 UTSW 9 121250902 missense possibly damaging 0.68
R4926:Ulk4 UTSW 9 121258732 missense probably benign 0.00
R4990:Ulk4 UTSW 9 121192786 missense probably benign 0.01
R6056:Ulk4 UTSW 9 121272955 missense probably damaging 1.00
R6448:Ulk4 UTSW 9 121103630 missense probably damaging 0.99
R6546:Ulk4 UTSW 9 121141894 missense probably damaging 1.00
R6668:Ulk4 UTSW 9 121188342 missense probably damaging 1.00
R6915:Ulk4 UTSW 9 121258820 missense probably benign
R6929:Ulk4 UTSW 9 121074015 missense probably benign 0.02
R7069:Ulk4 UTSW 9 121258810 missense probably benign 0.01
R7069:Ulk4 UTSW 9 121266517 missense probably benign 0.25
R7293:Ulk4 UTSW 9 121255124 missense probably damaging 1.00
R7299:Ulk4 UTSW 9 121145059 missense probably benign 0.32
R7301:Ulk4 UTSW 9 121145059 missense probably benign 0.32
R7337:Ulk4 UTSW 9 121248927 missense probably benign 0.44
R7395:Ulk4 UTSW 9 121255112 missense probably benign
R7423:Ulk4 UTSW 9 121103621 missense possibly damaging 0.48
R7545:Ulk4 UTSW 9 121141838 missense probably benign 0.00
R7753:Ulk4 UTSW 9 121266512 critical splice donor site probably null
R7790:Ulk4 UTSW 9 121263668 missense possibly damaging 0.70
R7791:Ulk4 UTSW 9 121263668 missense possibly damaging 0.70
R7793:Ulk4 UTSW 9 121263668 missense possibly damaging 0.70
R7834:Ulk4 UTSW 9 121263668 missense possibly damaging 0.70
R7836:Ulk4 UTSW 9 121044819 missense possibly damaging 0.72
R7960:Ulk4 UTSW 9 121272956 missense probably damaging 1.00
R8087:Ulk4 UTSW 9 121266251 missense probably damaging 0.99
R8203:Ulk4 UTSW 9 121168208 missense probably damaging 0.96
R8246:Ulk4 UTSW 9 121156875 makesense probably null
R8430:Ulk4 UTSW 9 121257078 critical splice donor site probably null
R8841:Ulk4 UTSW 9 121204738 missense probably damaging 1.00
R9014:Ulk4 UTSW 9 121188228 missense probably benign 0.00
R9092:Ulk4 UTSW 9 121073937 missense
R9176:Ulk4 UTSW 9 121145062 missense probably benign
R9235:Ulk4 UTSW 9 121152151 missense probably benign 0.13
X0024:Ulk4 UTSW 9 121192753 missense probably damaging 1.00
X0066:Ulk4 UTSW 9 121262606 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACACGTGAATCTTTACAACAGACTTC -3'
(R):5'- TCCCTAGAACTTGTGTAAGTCTTGC -3'

Sequencing Primer
(F):5'- GAATCTTTACAACAGACTTCTTGTGG -3'
(R):5'- GCATTTATGAATGTGTACTTCTCCTG -3'
Posted On 2022-01-20