Incidental Mutation 'R9126:Zfp169'
ID 693273
Institutional Source Beutler Lab
Gene Symbol Zfp169
Ensembl Gene ENSMUSG00000050954
Gene Name zinc finger protein 169
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.079) question?
Stock # R9126 (G1)
Quality Score 225.009
Status Not validated
Chromosome 13
Chromosomal Location 48487647-48513451 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 48491081 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 190 (E190G)
Ref Sequence ENSEMBL: ENSMUSP00000135414 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110110] [ENSMUST00000167682] [ENSMUST00000176176] [ENSMUST00000176949] [ENSMUST00000176996] [ENSMUST00000177530]
AlphaFold E9Q3R6
Predicted Effect unknown
Transcript: ENSMUST00000110110
AA Change: E190G
SMART Domains Protein: ENSMUSP00000105737
Gene: ENSMUSG00000050954
AA Change: E190G

DomainStartEndE-ValueType
KRAB 14 74 9.74e-36 SMART
ZnF_C2H2 257 279 9.08e-4 SMART
ZnF_C2H2 285 308 2.2e-2 SMART
ZnF_C2H2 314 336 9.73e-4 SMART
ZnF_C2H2 342 364 2.86e-1 SMART
ZnF_C2H2 370 392 4.72e-2 SMART
ZnF_C2H2 398 420 4.24e-4 SMART
ZnF_C2H2 426 448 1.13e-4 SMART
ZnF_C2H2 454 476 2.2e-2 SMART
ZnF_C2H2 482 504 2.99e-4 SMART
ZnF_C2H2 510 532 2.57e-3 SMART
ZnF_C2H2 539 561 3.44e-4 SMART
ZnF_C2H2 567 589 3.69e-4 SMART
ZnF_C2H2 595 617 8.02e-5 SMART
ZnF_C2H2 623 645 1.26e-2 SMART
ZnF_C2H2 651 673 4.79e-3 SMART
ZnF_C2H2 679 701 1.3e-4 SMART
ZnF_C2H2 707 729 5.5e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167682
SMART Domains Protein: ENSMUSP00000127591
Gene: ENSMUSG00000050954

DomainStartEndE-ValueType
KRAB 14 74 9.74e-36 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176176
SMART Domains Protein: ENSMUSP00000134793
Gene: ENSMUSG00000050954

DomainStartEndE-ValueType
KRAB 14 74 9.74e-36 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176949
SMART Domains Protein: ENSMUSP00000135695
Gene: ENSMUSG00000050954

DomainStartEndE-ValueType
KRAB 14 74 9.74e-36 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176996
SMART Domains Protein: ENSMUSP00000135520
Gene: ENSMUSG00000050954

DomainStartEndE-ValueType
KRAB 14 74 9.74e-36 SMART
Predicted Effect unknown
Transcript: ENSMUST00000177530
AA Change: E190G
SMART Domains Protein: ENSMUSP00000135414
Gene: ENSMUSG00000050954
AA Change: E190G

DomainStartEndE-ValueType
KRAB 14 74 9.74e-36 SMART
ZnF_C2H2 257 279 9.08e-4 SMART
ZnF_C2H2 285 308 2.2e-2 SMART
ZnF_C2H2 314 336 9.73e-4 SMART
ZnF_C2H2 342 364 2.86e-1 SMART
ZnF_C2H2 370 392 4.72e-2 SMART
ZnF_C2H2 398 420 4.24e-4 SMART
ZnF_C2H2 426 448 1.13e-4 SMART
ZnF_C2H2 454 476 2.2e-2 SMART
ZnF_C2H2 482 504 2.99e-4 SMART
ZnF_C2H2 510 532 2.57e-3 SMART
ZnF_C2H2 539 561 3.44e-4 SMART
ZnF_C2H2 567 589 3.69e-4 SMART
ZnF_C2H2 595 617 8.02e-5 SMART
ZnF_C2H2 623 645 1.26e-2 SMART
ZnF_C2H2 651 673 4.79e-3 SMART
ZnF_C2H2 679 701 1.3e-4 SMART
ZnF_C2H2 707 729 5.5e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous disruption of this locus does not result in an overt phenotype early in life. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610009O20Rik A G 18: 38,251,157 T35A probably benign Het
Adam30 G T 3: 98,160,991 V47L probably benign Het
Atm T C 9: 53,458,834 K2323R probably benign Het
Bbx A G 16: 50,200,450 L865P probably damaging Het
C2cd3 T A 7: 100,432,223 I1024N Het
Cacna1e A T 1: 154,467,764 C1161S probably benign Het
Caskin2 A T 11: 115,811,904 V26E possibly damaging Het
Ccnb3 T G X: 7,008,174 D722A probably damaging Het
Cep135 C A 5: 76,633,703 Q846K probably benign Het
Cfap44 A T 16: 44,475,256 D1639V possibly damaging Het
Cfh G T 1: 140,086,373 R1238S probably damaging Het
Dctn1 A T 6: 83,192,853 D712V probably damaging Het
Ddx21 T C 10: 62,588,700 D574G probably damaging Het
Dlgap5 A G 14: 47,401,532 I443T probably damaging Het
Dusp7 G A 9: 106,373,767 V364I Het
Entpd1 G T 19: 40,726,164 R268L possibly damaging Het
Fam69b A G 2: 26,635,977 T308A probably benign Het
Fermt3 C T 19: 7,002,377 A463T probably benign Het
Frat2 T C 19: 41,847,667 D82G probably damaging Het
Git1 T A 11: 77,499,554 I75N probably damaging Het
Gpr171 T A 3: 59,098,067 I96F probably damaging Het
Gzmb G T 14: 56,260,388 R132S probably benign Het
Hecw1 C T 13: 14,372,023 R132H probably damaging Het
Hey1 T G 3: 8,664,591 S269R probably benign Het
Hgf T A 5: 16,560,981 N38K possibly damaging Het
Lag3 T C 6: 124,904,846 R467G probably damaging Het
Lama3 A T 18: 12,450,470 H705L probably damaging Het
Lce3f T G 3: 92,993,020 S49R unknown Het
Lrrc49 T C 9: 60,671,311 D250G probably damaging Het
Lzts3 T C 2: 130,635,328 K400R possibly damaging Het
Macc1 T C 12: 119,445,976 S160P probably benign Het
Macf1 T C 4: 123,382,400 T6155A possibly damaging Het
Mboat4 C T 8: 34,115,194 T34I probably benign Het
Nav3 T A 10: 109,705,663 Q1913L probably benign Het
Notch4 T C 17: 34,581,106 S1014P probably benign Het
Olfr67 T G 7: 103,787,795 I161L probably benign Het
Olfr93 T C 17: 37,151,232 T247A possibly damaging Het
Olfr99 T C 17: 37,279,854 T189A probably benign Het
Orc2 A C 1: 58,476,469 H293Q probably benign Het
Otoa A G 7: 121,094,622 Y75C probably damaging Het
Pate2 T A 9: 35,670,612 probably null Het
Phldb3 G A 7: 24,627,301 V585I probably damaging Het
Plk3 ACACTCAC ACAC 4: 117,131,893 probably benign Het
Pou2f1 A T 1: 165,895,034 N443K unknown Het
Prkci T A 3: 31,018,644 F66I probably damaging Het
Ptprz1 C T 6: 23,002,335 Q1475* probably null Het
Qars C T 9: 108,509,200 R143C probably damaging Het
Reln T C 5: 21,955,196 D2125G probably damaging Het
Rp1 A T 1: 4,346,913 D1325E probably damaging Het
Rpl36a-ps1 A T 14: 98,994,258 C15S probably damaging Het
Rsf1 CG CGACGGCGGGG 7: 97,579,908 probably benign Het
Scn9a A G 2: 66,484,400 I1658T probably damaging Het
Serinc1 C T 10: 57,519,481 G370S probably benign Het
Spef1 G T 2: 131,171,909 T197K probably damaging Het
Sptan1 G A 2: 30,030,585 V2363I probably damaging Het
Ssh2 T A 11: 77,455,276 C1362* probably null Het
Star T C 8: 25,812,804 V258A probably benign Het
Sympk T C 7: 19,044,948 I588T possibly damaging Het
Tas2r136 T C 6: 132,777,621 N181S probably damaging Het
Tbc1d4 A T 14: 101,487,516 V555E probably benign Het
Thegl A G 5: 77,016,606 Y152C probably damaging Het
Topaz1 G A 9: 122,796,163 V1438I probably benign Het
Trmt112 T A 19: 6,910,418 M45K Het
Tshr G A 12: 91,537,218 R310H probably damaging Het
Ulk4 G T 9: 121,261,922 P238Q probably damaging Het
Unc5a T C 13: 54,997,961 L312P possibly damaging Het
Urb1 T C 16: 90,769,402 D1499G possibly damaging Het
Ushbp1 A G 8: 71,391,009 S262P probably damaging Het
Vmn1r173 G A 7: 23,702,583 R81K probably benign Het
Vmn2r5 G A 3: 64,491,738 P607S probably benign Het
Vtn G T 11: 78,500,430 G223V probably damaging Het
Zfhx4 T C 3: 5,329,529 V1061A probably damaging Het
Zfp616 T A 11: 74,085,454 C850S probably damaging Het
Other mutations in Zfp169
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01925:Zfp169 APN 13 48490763 unclassified probably benign
IGL03329:Zfp169 APN 13 48490794 unclassified probably benign
IGL03382:Zfp169 APN 13 48491163 unclassified probably benign
IGL03394:Zfp169 APN 13 48489924 missense possibly damaging 0.93
BB010:Zfp169 UTSW 13 48490481 missense unknown
BB020:Zfp169 UTSW 13 48490481 missense unknown
R0571:Zfp169 UTSW 13 48489690 missense possibly damaging 0.71
R1714:Zfp169 UTSW 13 48498854 missense probably benign 0.35
R1784:Zfp169 UTSW 13 48489819 missense possibly damaging 0.61
R3108:Zfp169 UTSW 13 48489996 missense possibly damaging 0.86
R3689:Zfp169 UTSW 13 48506901 splice site probably benign
R4444:Zfp169 UTSW 13 48490337 missense possibly damaging 0.94
R4665:Zfp169 UTSW 13 48490863 unclassified probably benign
R4719:Zfp169 UTSW 13 48490158 missense probably benign 0.06
R4745:Zfp169 UTSW 13 48490232 missense possibly damaging 0.71
R5288:Zfp169 UTSW 13 48490275 missense possibly damaging 0.61
R5384:Zfp169 UTSW 13 48490275 missense possibly damaging 0.61
R5979:Zfp169 UTSW 13 48491040 unclassified probably benign
R6053:Zfp169 UTSW 13 48498858 missense probably damaging 1.00
R6823:Zfp169 UTSW 13 48490996 unclassified probably benign
R7084:Zfp169 UTSW 13 48498863 missense probably benign 0.10
R7679:Zfp169 UTSW 13 48498383 missense probably damaging 0.99
R7933:Zfp169 UTSW 13 48490481 missense unknown
R8298:Zfp169 UTSW 13 48498377 nonsense probably null
R8322:Zfp169 UTSW 13 48491099 missense unknown
R9047:Zfp169 UTSW 13 48498816 missense probably damaging 1.00
R9124:Zfp169 UTSW 13 48491081 missense unknown
R9131:Zfp169 UTSW 13 48491081 missense unknown
R9132:Zfp169 UTSW 13 48491081 missense unknown
Predicted Primers PCR Primer
(F):5'- AACACGAGTAAGGCTTCTCCAC -3'
(R):5'- AGCAACTTCCAGTCAGAAGC -3'

Sequencing Primer
(F):5'- CATTCTCTGGAGCTTCATGAGG -3'
(R):5'- TTCCAGTCAGAAGCTCCAGG -3'
Posted On 2022-01-20