Incidental Mutation 'R9126:Zfp169'
ID 693273
Institutional Source Beutler Lab
Gene Symbol Zfp169
Ensembl Gene ENSMUSG00000050954
Gene Name zinc finger protein 169
Synonyms 4930429A13Rik, 1700025J14Rik
Accession Numbers
Essential gene? Probably non essential (E-score: 0.072) question?
Stock # R9126 (G1)
Quality Score 225.009
Status Not validated
Chromosome 13
Chromosomal Location 48641123-48666927 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 48644557 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 190 (E190G)
Ref Sequence ENSEMBL: ENSMUSP00000135414 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110110] [ENSMUST00000167682] [ENSMUST00000176176] [ENSMUST00000176949] [ENSMUST00000176996] [ENSMUST00000177530]
AlphaFold E9Q3R6
Predicted Effect unknown
Transcript: ENSMUST00000110110
AA Change: E190G
SMART Domains Protein: ENSMUSP00000105737
Gene: ENSMUSG00000050954
AA Change: E190G

DomainStartEndE-ValueType
KRAB 14 74 9.74e-36 SMART
ZnF_C2H2 257 279 9.08e-4 SMART
ZnF_C2H2 285 308 2.2e-2 SMART
ZnF_C2H2 314 336 9.73e-4 SMART
ZnF_C2H2 342 364 2.86e-1 SMART
ZnF_C2H2 370 392 4.72e-2 SMART
ZnF_C2H2 398 420 4.24e-4 SMART
ZnF_C2H2 426 448 1.13e-4 SMART
ZnF_C2H2 454 476 2.2e-2 SMART
ZnF_C2H2 482 504 2.99e-4 SMART
ZnF_C2H2 510 532 2.57e-3 SMART
ZnF_C2H2 539 561 3.44e-4 SMART
ZnF_C2H2 567 589 3.69e-4 SMART
ZnF_C2H2 595 617 8.02e-5 SMART
ZnF_C2H2 623 645 1.26e-2 SMART
ZnF_C2H2 651 673 4.79e-3 SMART
ZnF_C2H2 679 701 1.3e-4 SMART
ZnF_C2H2 707 729 5.5e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167682
SMART Domains Protein: ENSMUSP00000127591
Gene: ENSMUSG00000050954

DomainStartEndE-ValueType
KRAB 14 74 9.74e-36 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176176
SMART Domains Protein: ENSMUSP00000134793
Gene: ENSMUSG00000050954

DomainStartEndE-ValueType
KRAB 14 74 9.74e-36 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176949
SMART Domains Protein: ENSMUSP00000135695
Gene: ENSMUSG00000050954

DomainStartEndE-ValueType
KRAB 14 74 9.74e-36 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176996
SMART Domains Protein: ENSMUSP00000135520
Gene: ENSMUSG00000050954

DomainStartEndE-ValueType
KRAB 14 74 9.74e-36 SMART
Predicted Effect unknown
Transcript: ENSMUST00000177530
AA Change: E190G
SMART Domains Protein: ENSMUSP00000135414
Gene: ENSMUSG00000050954
AA Change: E190G

DomainStartEndE-ValueType
KRAB 14 74 9.74e-36 SMART
ZnF_C2H2 257 279 9.08e-4 SMART
ZnF_C2H2 285 308 2.2e-2 SMART
ZnF_C2H2 314 336 9.73e-4 SMART
ZnF_C2H2 342 364 2.86e-1 SMART
ZnF_C2H2 370 392 4.72e-2 SMART
ZnF_C2H2 398 420 4.24e-4 SMART
ZnF_C2H2 426 448 1.13e-4 SMART
ZnF_C2H2 454 476 2.2e-2 SMART
ZnF_C2H2 482 504 2.99e-4 SMART
ZnF_C2H2 510 532 2.57e-3 SMART
ZnF_C2H2 539 561 3.44e-4 SMART
ZnF_C2H2 567 589 3.69e-4 SMART
ZnF_C2H2 595 617 8.02e-5 SMART
ZnF_C2H2 623 645 1.26e-2 SMART
ZnF_C2H2 651 673 4.79e-3 SMART
ZnF_C2H2 679 701 1.3e-4 SMART
ZnF_C2H2 707 729 5.5e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous disruption of this locus does not result in an overt phenotype early in life. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam30 G T 3: 98,068,307 (GRCm39) V47L probably benign Het
Atm T C 9: 53,370,134 (GRCm39) K2323R probably benign Het
Bbx A G 16: 50,020,813 (GRCm39) L865P probably damaging Het
C2cd3 T A 7: 100,081,430 (GRCm39) I1024N Het
Cacna1e A T 1: 154,343,510 (GRCm39) C1161S probably benign Het
Caskin2 A T 11: 115,702,730 (GRCm39) V26E possibly damaging Het
Ccnb3 T G X: 6,874,413 (GRCm39) D722A probably damaging Het
Cep135 C A 5: 76,781,550 (GRCm39) Q846K probably benign Het
Cfap44 A T 16: 44,295,619 (GRCm39) D1639V possibly damaging Het
Cfh G T 1: 140,014,111 (GRCm39) R1238S probably damaging Het
Dctn1 A T 6: 83,169,835 (GRCm39) D712V probably damaging Het
Ddx21 T C 10: 62,424,479 (GRCm39) D574G probably damaging Het
Dele1 A G 18: 38,384,210 (GRCm39) T35A probably benign Het
Dipk1b A G 2: 26,525,989 (GRCm39) T308A probably benign Het
Dlgap5 A G 14: 47,638,989 (GRCm39) I443T probably damaging Het
Dusp7 G A 9: 106,250,966 (GRCm39) V364I Het
Entpd1 G T 19: 40,714,608 (GRCm39) R268L possibly damaging Het
Fermt3 C T 19: 6,979,745 (GRCm39) A463T probably benign Het
Frat2 T C 19: 41,836,106 (GRCm39) D82G probably damaging Het
Git1 T A 11: 77,390,380 (GRCm39) I75N probably damaging Het
Gpr171 T A 3: 59,005,488 (GRCm39) I96F probably damaging Het
Gzmb G T 14: 56,497,845 (GRCm39) R132S probably benign Het
Hecw1 C T 13: 14,546,608 (GRCm39) R132H probably damaging Het
Hey1 T G 3: 8,729,651 (GRCm39) S269R probably benign Het
Hgf T A 5: 16,765,979 (GRCm39) N38K possibly damaging Het
Lag3 T C 6: 124,881,809 (GRCm39) R467G probably damaging Het
Lama3 A T 18: 12,583,527 (GRCm39) H705L probably damaging Het
Lce3f T G 3: 92,900,327 (GRCm39) S49R unknown Het
Lrrc49 T C 9: 60,578,594 (GRCm39) D250G probably damaging Het
Lzts3 T C 2: 130,477,248 (GRCm39) K400R possibly damaging Het
Macc1 T C 12: 119,409,711 (GRCm39) S160P probably benign Het
Macf1 T C 4: 123,276,193 (GRCm39) T6155A possibly damaging Het
Mboat4 C T 8: 34,582,348 (GRCm39) T34I probably benign Het
Nav3 T A 10: 109,541,524 (GRCm39) Q1913L probably benign Het
Notch4 T C 17: 34,800,080 (GRCm39) S1014P probably benign Het
Or1o4 T C 17: 37,590,745 (GRCm39) T189A probably benign Het
Or2h1b T C 17: 37,462,123 (GRCm39) T247A possibly damaging Het
Or52z1 T G 7: 103,437,002 (GRCm39) I161L probably benign Het
Orc2 A C 1: 58,515,628 (GRCm39) H293Q probably benign Het
Otoa A G 7: 120,693,845 (GRCm39) Y75C probably damaging Het
Pate2 T A 9: 35,581,908 (GRCm39) probably null Het
Phldb3 G A 7: 24,326,726 (GRCm39) V585I probably damaging Het
Plk3 ACACTCAC ACAC 4: 116,989,090 (GRCm39) probably benign Het
Pou2f1 A T 1: 165,722,603 (GRCm39) N443K unknown Het
Prkci T A 3: 31,072,793 (GRCm39) F66I probably damaging Het
Ptprz1 C T 6: 23,002,334 (GRCm39) Q1475* probably null Het
Qars1 C T 9: 108,386,399 (GRCm39) R143C probably damaging Het
Reln T C 5: 22,160,194 (GRCm39) D2125G probably damaging Het
Rp1 A T 1: 4,417,136 (GRCm39) D1325E probably damaging Het
Rpl36a-ps1 A T 14: 99,231,694 (GRCm39) C15S probably damaging Het
Rsf1 CG CGACGGCGGGG 7: 97,229,115 (GRCm39) probably benign Het
Scn9a A G 2: 66,314,744 (GRCm39) I1658T probably damaging Het
Serinc1 C T 10: 57,395,577 (GRCm39) G370S probably benign Het
Spef1 G T 2: 131,013,829 (GRCm39) T197K probably damaging Het
Spmap2l A G 5: 77,164,453 (GRCm39) Y152C probably damaging Het
Sptan1 G A 2: 29,920,597 (GRCm39) V2363I probably damaging Het
Ssh2 T A 11: 77,346,102 (GRCm39) C1362* probably null Het
Star T C 8: 26,302,832 (GRCm39) V258A probably benign Het
Sympk T C 7: 18,778,873 (GRCm39) I588T possibly damaging Het
Tas2r136 T C 6: 132,754,584 (GRCm39) N181S probably damaging Het
Tbc1d4 A T 14: 101,724,952 (GRCm39) V555E probably benign Het
Topaz1 G A 9: 122,625,228 (GRCm39) V1438I probably benign Het
Trmt112 T A 19: 6,887,786 (GRCm39) M45K Het
Tshr G A 12: 91,503,992 (GRCm39) R310H probably damaging Het
Ulk4 G T 9: 121,090,988 (GRCm39) P238Q probably damaging Het
Unc5a T C 13: 55,145,774 (GRCm39) L312P possibly damaging Het
Urb1 T C 16: 90,566,290 (GRCm39) D1499G possibly damaging Het
Ushbp1 A G 8: 71,843,653 (GRCm39) S262P probably damaging Het
Vmn1r173 G A 7: 23,402,008 (GRCm39) R81K probably benign Het
Vmn2r5 G A 3: 64,399,159 (GRCm39) P607S probably benign Het
Vtn G T 11: 78,391,256 (GRCm39) G223V probably damaging Het
Zfhx4 T C 3: 5,394,589 (GRCm39) V1061A probably damaging Het
Zfp616 T A 11: 73,976,280 (GRCm39) C850S probably damaging Het
Other mutations in Zfp169
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01925:Zfp169 APN 13 48,644,239 (GRCm39) unclassified probably benign
IGL03329:Zfp169 APN 13 48,644,270 (GRCm39) unclassified probably benign
IGL03382:Zfp169 APN 13 48,644,639 (GRCm39) unclassified probably benign
IGL03394:Zfp169 APN 13 48,643,400 (GRCm39) missense possibly damaging 0.93
BB010:Zfp169 UTSW 13 48,643,957 (GRCm39) missense unknown
BB020:Zfp169 UTSW 13 48,643,957 (GRCm39) missense unknown
R0571:Zfp169 UTSW 13 48,643,166 (GRCm39) missense possibly damaging 0.71
R1714:Zfp169 UTSW 13 48,652,330 (GRCm39) missense probably benign 0.35
R1784:Zfp169 UTSW 13 48,643,295 (GRCm39) missense possibly damaging 0.61
R3108:Zfp169 UTSW 13 48,643,472 (GRCm39) missense possibly damaging 0.86
R3689:Zfp169 UTSW 13 48,660,377 (GRCm39) splice site probably benign
R4444:Zfp169 UTSW 13 48,643,813 (GRCm39) missense possibly damaging 0.94
R4665:Zfp169 UTSW 13 48,644,339 (GRCm39) unclassified probably benign
R4719:Zfp169 UTSW 13 48,643,634 (GRCm39) missense probably benign 0.06
R4745:Zfp169 UTSW 13 48,643,708 (GRCm39) missense possibly damaging 0.71
R5288:Zfp169 UTSW 13 48,643,751 (GRCm39) missense possibly damaging 0.61
R5384:Zfp169 UTSW 13 48,643,751 (GRCm39) missense possibly damaging 0.61
R5979:Zfp169 UTSW 13 48,644,516 (GRCm39) unclassified probably benign
R6053:Zfp169 UTSW 13 48,652,334 (GRCm39) missense probably damaging 1.00
R6823:Zfp169 UTSW 13 48,644,472 (GRCm39) unclassified probably benign
R7084:Zfp169 UTSW 13 48,652,339 (GRCm39) missense probably benign 0.10
R7679:Zfp169 UTSW 13 48,651,859 (GRCm39) missense probably damaging 0.99
R7933:Zfp169 UTSW 13 48,643,957 (GRCm39) missense unknown
R8298:Zfp169 UTSW 13 48,651,853 (GRCm39) nonsense probably null
R8322:Zfp169 UTSW 13 48,644,575 (GRCm39) missense unknown
R9047:Zfp169 UTSW 13 48,652,292 (GRCm39) missense probably damaging 1.00
R9124:Zfp169 UTSW 13 48,644,557 (GRCm39) missense unknown
R9131:Zfp169 UTSW 13 48,644,557 (GRCm39) missense unknown
R9132:Zfp169 UTSW 13 48,644,557 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- AACACGAGTAAGGCTTCTCCAC -3'
(R):5'- AGCAACTTCCAGTCAGAAGC -3'

Sequencing Primer
(F):5'- CATTCTCTGGAGCTTCATGAGG -3'
(R):5'- TTCCAGTCAGAAGCTCCAGG -3'
Posted On 2022-01-20