Incidental Mutation 'R9126:Dlgap5'
ID 693275
Institutional Source Beutler Lab
Gene Symbol Dlgap5
Ensembl Gene ENSMUSG00000037544
Gene Name DLG associated protein 5
Synonyms Dlg7, C86398, Hurp
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.867) question?
Stock # R9126 (G1)
Quality Score 225.009
Status Not validated
Chromosome 14
Chromosomal Location 47387779-47418407 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 47401532 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 443 (I443T)
Ref Sequence ENSEMBL: ENSMUSP00000040416 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043296] [ENSMUST00000178661] [ENSMUST00000180299]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000043296
AA Change: I443T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000040416
Gene: ENSMUSG00000037544
AA Change: I443T

DomainStartEndE-ValueType
coiled coil region 86 116 N/A INTRINSIC
Pfam:GKAP 327 590 2.2e-38 PFAM
low complexity region 735 757 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000107408
Gene: ENSMUSG00000037544
AA Change: I241T

DomainStartEndE-ValueType
Pfam:GKAP 78 303 3.9e-28 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000178661
AA Change: I443T

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Predicted Effect possibly damaging
Transcript: ENSMUST00000180299
AA Change: I443T

PolyPhen 2 Score 0.873 (Sensitivity: 0.83; Specificity: 0.93)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null mutation display female infertility resulting from a defect in decidualization. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610009O20Rik A G 18: 38,251,157 T35A probably benign Het
Adam30 G T 3: 98,160,991 V47L probably benign Het
Atm T C 9: 53,458,834 K2323R probably benign Het
Bbx A G 16: 50,200,450 L865P probably damaging Het
C2cd3 T A 7: 100,432,223 I1024N Het
Cacna1e A T 1: 154,467,764 C1161S probably benign Het
Caskin2 A T 11: 115,811,904 V26E possibly damaging Het
Ccnb3 T G X: 7,008,174 D722A probably damaging Het
Cep135 C A 5: 76,633,703 Q846K probably benign Het
Cfap44 A T 16: 44,475,256 D1639V possibly damaging Het
Cfh G T 1: 140,086,373 R1238S probably damaging Het
Dctn1 A T 6: 83,192,853 D712V probably damaging Het
Ddx21 T C 10: 62,588,700 D574G probably damaging Het
Dusp7 G A 9: 106,373,767 V364I Het
Entpd1 G T 19: 40,726,164 R268L possibly damaging Het
Fam69b A G 2: 26,635,977 T308A probably benign Het
Fermt3 C T 19: 7,002,377 A463T probably benign Het
Frat2 T C 19: 41,847,667 D82G probably damaging Het
Git1 T A 11: 77,499,554 I75N probably damaging Het
Gpr171 T A 3: 59,098,067 I96F probably damaging Het
Gzmb G T 14: 56,260,388 R132S probably benign Het
Hecw1 C T 13: 14,372,023 R132H probably damaging Het
Hey1 T G 3: 8,664,591 S269R probably benign Het
Hgf T A 5: 16,560,981 N38K possibly damaging Het
Lag3 T C 6: 124,904,846 R467G probably damaging Het
Lama3 A T 18: 12,450,470 H705L probably damaging Het
Lce3f T G 3: 92,993,020 S49R unknown Het
Lrrc49 T C 9: 60,671,311 D250G probably damaging Het
Lzts3 T C 2: 130,635,328 K400R possibly damaging Het
Macc1 T C 12: 119,445,976 S160P probably benign Het
Macf1 T C 4: 123,382,400 T6155A possibly damaging Het
Mboat4 C T 8: 34,115,194 T34I probably benign Het
Nav3 T A 10: 109,705,663 Q1913L probably benign Het
Notch4 T C 17: 34,581,106 S1014P probably benign Het
Olfr67 T G 7: 103,787,795 I161L probably benign Het
Olfr93 T C 17: 37,151,232 T247A possibly damaging Het
Olfr99 T C 17: 37,279,854 T189A probably benign Het
Orc2 A C 1: 58,476,469 H293Q probably benign Het
Otoa A G 7: 121,094,622 Y75C probably damaging Het
Pate2 T A 9: 35,670,612 probably null Het
Phldb3 G A 7: 24,627,301 V585I probably damaging Het
Plk3 ACACTCAC ACAC 4: 117,131,893 probably benign Het
Pou2f1 A T 1: 165,895,034 N443K unknown Het
Prkci T A 3: 31,018,644 F66I probably damaging Het
Ptprz1 C T 6: 23,002,335 Q1475* probably null Het
Qars C T 9: 108,509,200 R143C probably damaging Het
Reln T C 5: 21,955,196 D2125G probably damaging Het
Rp1 A T 1: 4,346,913 D1325E probably damaging Het
Rpl36a-ps1 A T 14: 98,994,258 C15S probably damaging Het
Rsf1 CG CGACGGCGGGG 7: 97,579,908 probably benign Het
Scn9a A G 2: 66,484,400 I1658T probably damaging Het
Serinc1 C T 10: 57,519,481 G370S probably benign Het
Spef1 G T 2: 131,171,909 T197K probably damaging Het
Sptan1 G A 2: 30,030,585 V2363I probably damaging Het
Ssh2 T A 11: 77,455,276 C1362* probably null Het
Star T C 8: 25,812,804 V258A probably benign Het
Sympk T C 7: 19,044,948 I588T possibly damaging Het
Tas2r136 T C 6: 132,777,621 N181S probably damaging Het
Tbc1d4 A T 14: 101,487,516 V555E probably benign Het
Thegl A G 5: 77,016,606 Y152C probably damaging Het
Topaz1 G A 9: 122,796,163 V1438I probably benign Het
Trmt112 T A 19: 6,910,418 M45K Het
Tshr G A 12: 91,537,218 R310H probably damaging Het
Ulk4 G T 9: 121,261,922 P238Q probably damaging Het
Unc5a T C 13: 54,997,961 L312P possibly damaging Het
Urb1 T C 16: 90,769,402 D1499G possibly damaging Het
Ushbp1 A G 8: 71,391,009 S262P probably damaging Het
Vmn1r173 G A 7: 23,702,583 R81K probably benign Het
Vmn2r5 G A 3: 64,491,738 P607S probably benign Het
Vtn G T 11: 78,500,430 G223V probably damaging Het
Zfhx4 T C 3: 5,329,529 V1061A probably damaging Het
Zfp169 T C 13: 48,491,081 E190G unknown Het
Zfp616 T A 11: 74,085,454 C850S probably damaging Het
Other mutations in Dlgap5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00981:Dlgap5 APN 14 47398468 missense probably damaging 1.00
IGL01110:Dlgap5 APN 14 47394326 splice site probably benign
IGL02943:Dlgap5 APN 14 47412976 critical splice donor site probably null
PIT4453001:Dlgap5 UTSW 14 47401522 frame shift probably null
R0189:Dlgap5 UTSW 14 47412975 splice site probably null
R0383:Dlgap5 UTSW 14 47410361 missense probably benign 0.01
R1078:Dlgap5 UTSW 14 47399566 missense probably damaging 1.00
R1915:Dlgap5 UTSW 14 47407773 missense probably benign 0.00
R1959:Dlgap5 UTSW 14 47416386 missense possibly damaging 0.88
R2051:Dlgap5 UTSW 14 47411484 missense probably benign 0.01
R2145:Dlgap5 UTSW 14 47395923 nonsense probably null
R2922:Dlgap5 UTSW 14 47390441 critical splice donor site probably null
R4261:Dlgap5 UTSW 14 47413788 missense probably damaging 1.00
R4607:Dlgap5 UTSW 14 47413018 missense possibly damaging 0.87
R4724:Dlgap5 UTSW 14 47401520 critical splice donor site probably null
R4898:Dlgap5 UTSW 14 47413819 missense probably benign 0.01
R5135:Dlgap5 UTSW 14 47399665 missense probably damaging 1.00
R5154:Dlgap5 UTSW 14 47413720 missense probably damaging 1.00
R5650:Dlgap5 UTSW 14 47411739 missense probably benign 0.01
R5849:Dlgap5 UTSW 14 47389435 missense possibly damaging 0.95
R5958:Dlgap5 UTSW 14 47413754 missense probably damaging 1.00
R6845:Dlgap5 UTSW 14 47416563 missense possibly damaging 0.79
R7163:Dlgap5 UTSW 14 47399638 missense probably damaging 1.00
R7529:Dlgap5 UTSW 14 47416419 missense probably damaging 1.00
R7646:Dlgap5 UTSW 14 47399519 critical splice donor site probably null
R8029:Dlgap5 UTSW 14 47416440 missense probably benign 0.01
R8084:Dlgap5 UTSW 14 47407841 missense probably benign 0.00
R9166:Dlgap5 UTSW 14 47413749 missense probably damaging 1.00
Z1177:Dlgap5 UTSW 14 47388063 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CAAGATCCTGGGCTGAATCTC -3'
(R):5'- GCTTTAAACCGTTCTAATCCTGG -3'

Sequencing Primer
(F):5'- CCACATAAGCACTTTGTGGTCAGG -3'
(R):5'- CTAATCCTGGATATTCTGTCAGAGTG -3'
Posted On 2022-01-20