Incidental Mutation 'R9126:Or1o4'
ID 693284
Institutional Source Beutler Lab
Gene Symbol Or1o4
Ensembl Gene ENSMUSG00000061972
Gene Name olfactory receptor family 1 subfamily O member 4
Synonyms MOR156-1, GA_x6K02T2PSCP-1720261-1719344, Olfr99
Accession Numbers
Essential gene? Probably non essential (E-score: 0.174) question?
Stock # R9126 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 37590392-37591309 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 37590745 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 189 (T189A)
Ref Sequence ENSEMBL: ENSMUSP00000148900 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077585] [ENSMUST00000216328]
AlphaFold Q8VFE4
Predicted Effect probably benign
Transcript: ENSMUST00000077585
AA Change: T189A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000076781
Gene: ENSMUSG00000061972
AA Change: T189A

DomainStartEndE-ValueType
Pfam:7tm_4 28 305 1.8e-58 PFAM
Pfam:7TM_GPCR_Srsx 32 302 1.4e-6 PFAM
Pfam:7tm_1 38 287 1e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173568
Predicted Effect probably benign
Transcript: ENSMUST00000216328
AA Change: T189A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216370
Meta Mutation Damage Score 0.2707 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam30 G T 3: 98,068,307 (GRCm39) V47L probably benign Het
Atm T C 9: 53,370,134 (GRCm39) K2323R probably benign Het
Bbx A G 16: 50,020,813 (GRCm39) L865P probably damaging Het
C2cd3 T A 7: 100,081,430 (GRCm39) I1024N Het
Cacna1e A T 1: 154,343,510 (GRCm39) C1161S probably benign Het
Caskin2 A T 11: 115,702,730 (GRCm39) V26E possibly damaging Het
Ccnb3 T G X: 6,874,413 (GRCm39) D722A probably damaging Het
Cep135 C A 5: 76,781,550 (GRCm39) Q846K probably benign Het
Cfap44 A T 16: 44,295,619 (GRCm39) D1639V possibly damaging Het
Cfh G T 1: 140,014,111 (GRCm39) R1238S probably damaging Het
Dctn1 A T 6: 83,169,835 (GRCm39) D712V probably damaging Het
Ddx21 T C 10: 62,424,479 (GRCm39) D574G probably damaging Het
Dele1 A G 18: 38,384,210 (GRCm39) T35A probably benign Het
Dipk1b A G 2: 26,525,989 (GRCm39) T308A probably benign Het
Dlgap5 A G 14: 47,638,989 (GRCm39) I443T probably damaging Het
Dusp7 G A 9: 106,250,966 (GRCm39) V364I Het
Entpd1 G T 19: 40,714,608 (GRCm39) R268L possibly damaging Het
Fermt3 C T 19: 6,979,745 (GRCm39) A463T probably benign Het
Frat2 T C 19: 41,836,106 (GRCm39) D82G probably damaging Het
Git1 T A 11: 77,390,380 (GRCm39) I75N probably damaging Het
Gpr171 T A 3: 59,005,488 (GRCm39) I96F probably damaging Het
Gzmb G T 14: 56,497,845 (GRCm39) R132S probably benign Het
Hecw1 C T 13: 14,546,608 (GRCm39) R132H probably damaging Het
Hey1 T G 3: 8,729,651 (GRCm39) S269R probably benign Het
Hgf T A 5: 16,765,979 (GRCm39) N38K possibly damaging Het
Lag3 T C 6: 124,881,809 (GRCm39) R467G probably damaging Het
Lama3 A T 18: 12,583,527 (GRCm39) H705L probably damaging Het
Lce3f T G 3: 92,900,327 (GRCm39) S49R unknown Het
Lrrc49 T C 9: 60,578,594 (GRCm39) D250G probably damaging Het
Lzts3 T C 2: 130,477,248 (GRCm39) K400R possibly damaging Het
Macc1 T C 12: 119,409,711 (GRCm39) S160P probably benign Het
Macf1 T C 4: 123,276,193 (GRCm39) T6155A possibly damaging Het
Mboat4 C T 8: 34,582,348 (GRCm39) T34I probably benign Het
Nav3 T A 10: 109,541,524 (GRCm39) Q1913L probably benign Het
Notch4 T C 17: 34,800,080 (GRCm39) S1014P probably benign Het
Or2h1b T C 17: 37,462,123 (GRCm39) T247A possibly damaging Het
Or52z1 T G 7: 103,437,002 (GRCm39) I161L probably benign Het
Orc2 A C 1: 58,515,628 (GRCm39) H293Q probably benign Het
Otoa A G 7: 120,693,845 (GRCm39) Y75C probably damaging Het
Pate2 T A 9: 35,581,908 (GRCm39) probably null Het
Phldb3 G A 7: 24,326,726 (GRCm39) V585I probably damaging Het
Plk3 ACACTCAC ACAC 4: 116,989,090 (GRCm39) probably benign Het
Pou2f1 A T 1: 165,722,603 (GRCm39) N443K unknown Het
Prkci T A 3: 31,072,793 (GRCm39) F66I probably damaging Het
Ptprz1 C T 6: 23,002,334 (GRCm39) Q1475* probably null Het
Qars1 C T 9: 108,386,399 (GRCm39) R143C probably damaging Het
Reln T C 5: 22,160,194 (GRCm39) D2125G probably damaging Het
Rp1 A T 1: 4,417,136 (GRCm39) D1325E probably damaging Het
Rpl36a-ps1 A T 14: 99,231,694 (GRCm39) C15S probably damaging Het
Rsf1 CG CGACGGCGGGG 7: 97,229,115 (GRCm39) probably benign Het
Scn9a A G 2: 66,314,744 (GRCm39) I1658T probably damaging Het
Serinc1 C T 10: 57,395,577 (GRCm39) G370S probably benign Het
Spef1 G T 2: 131,013,829 (GRCm39) T197K probably damaging Het
Spmap2l A G 5: 77,164,453 (GRCm39) Y152C probably damaging Het
Sptan1 G A 2: 29,920,597 (GRCm39) V2363I probably damaging Het
Ssh2 T A 11: 77,346,102 (GRCm39) C1362* probably null Het
Star T C 8: 26,302,832 (GRCm39) V258A probably benign Het
Sympk T C 7: 18,778,873 (GRCm39) I588T possibly damaging Het
Tas2r136 T C 6: 132,754,584 (GRCm39) N181S probably damaging Het
Tbc1d4 A T 14: 101,724,952 (GRCm39) V555E probably benign Het
Topaz1 G A 9: 122,625,228 (GRCm39) V1438I probably benign Het
Trmt112 T A 19: 6,887,786 (GRCm39) M45K Het
Tshr G A 12: 91,503,992 (GRCm39) R310H probably damaging Het
Ulk4 G T 9: 121,090,988 (GRCm39) P238Q probably damaging Het
Unc5a T C 13: 55,145,774 (GRCm39) L312P possibly damaging Het
Urb1 T C 16: 90,566,290 (GRCm39) D1499G possibly damaging Het
Ushbp1 A G 8: 71,843,653 (GRCm39) S262P probably damaging Het
Vmn1r173 G A 7: 23,402,008 (GRCm39) R81K probably benign Het
Vmn2r5 G A 3: 64,399,159 (GRCm39) P607S probably benign Het
Vtn G T 11: 78,391,256 (GRCm39) G223V probably damaging Het
Zfhx4 T C 3: 5,394,589 (GRCm39) V1061A probably damaging Het
Zfp169 T C 13: 48,644,557 (GRCm39) E190G unknown Het
Zfp616 T A 11: 73,976,280 (GRCm39) C850S probably damaging Het
Other mutations in Or1o4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01878:Or1o4 APN 17 37,590,891 (GRCm39) missense possibly damaging 0.46
IGL02954:Or1o4 APN 17 37,591,195 (GRCm39) missense probably damaging 1.00
R0533:Or1o4 UTSW 17 37,591,182 (GRCm39) nonsense probably null
R1480:Or1o4 UTSW 17 37,590,636 (GRCm39) missense probably benign 0.01
R2872:Or1o4 UTSW 17 37,590,867 (GRCm39) missense possibly damaging 0.64
R2872:Or1o4 UTSW 17 37,590,867 (GRCm39) missense possibly damaging 0.64
R3772:Or1o4 UTSW 17 37,590,745 (GRCm39) missense probably benign 0.00
R3826:Or1o4 UTSW 17 37,591,140 (GRCm39) missense probably damaging 1.00
R3827:Or1o4 UTSW 17 37,591,140 (GRCm39) missense probably damaging 1.00
R3829:Or1o4 UTSW 17 37,591,140 (GRCm39) missense probably damaging 1.00
R5210:Or1o4 UTSW 17 37,590,824 (GRCm39) missense probably benign 0.13
R5361:Or1o4 UTSW 17 37,590,501 (GRCm39) missense probably benign 0.02
R6213:Or1o4 UTSW 17 37,591,264 (GRCm39) missense probably benign
R6399:Or1o4 UTSW 17 37,590,666 (GRCm39) missense probably damaging 1.00
R6881:Or1o4 UTSW 17 37,591,200 (GRCm39) missense probably benign 0.01
R7938:Or1o4 UTSW 17 37,590,991 (GRCm39) missense probably benign 0.03
R8097:Or1o4 UTSW 17 37,590,818 (GRCm39) nonsense probably null
R8125:Or1o4 UTSW 17 37,590,935 (GRCm39) missense probably benign 0.01
R8218:Or1o4 UTSW 17 37,590,711 (GRCm39) missense probably benign
R9050:Or1o4 UTSW 17 37,590,820 (GRCm39) missense probably damaging 0.97
R9434:Or1o4 UTSW 17 37,591,254 (GRCm39) missense probably benign 0.01
R9495:Or1o4 UTSW 17 37,591,386 (GRCm39) start gained probably benign
R9514:Or1o4 UTSW 17 37,591,386 (GRCm39) start gained probably benign
Z1176:Or1o4 UTSW 17 37,590,565 (GRCm39) missense probably damaging 0.99
Z1177:Or1o4 UTSW 17 37,591,100 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGTAGCAAAGACTGTGCTGTAG -3'
(R):5'- GCTATCTGTCATCCACTGCG -3'

Sequencing Primer
(F):5'- CTGTGCTGTAGAAAAGGAGGACTAC -3'
(R):5'- GTCATCCACTGCGCTACTCAG -3'
Posted On 2022-01-20