Incidental Mutation 'R9126:Olfr99'
ID 693284
Institutional Source Beutler Lab
Gene Symbol Olfr99
Ensembl Gene ENSMUSG00000061972
Gene Name olfactory receptor 99
Synonyms MOR156-1, GA_x6K02T2PSCP-1720261-1719344
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.352) question?
Stock # R9126 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 37279043-37283460 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 37279854 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 189 (T189A)
Ref Sequence ENSEMBL: ENSMUSP00000148900 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077585] [ENSMUST00000216328]
AlphaFold Q8VFE4
Predicted Effect probably benign
Transcript: ENSMUST00000077585
AA Change: T189A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000076781
Gene: ENSMUSG00000061972
AA Change: T189A

DomainStartEndE-ValueType
Pfam:7tm_4 28 305 1.8e-58 PFAM
Pfam:7TM_GPCR_Srsx 32 302 1.4e-6 PFAM
Pfam:7tm_1 38 287 1e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173568
Predicted Effect probably benign
Transcript: ENSMUST00000216328
AA Change: T189A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216370
Meta Mutation Damage Score 0.2707 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610009O20Rik A G 18: 38,251,157 T35A probably benign Het
Adam30 G T 3: 98,160,991 V47L probably benign Het
Atm T C 9: 53,458,834 K2323R probably benign Het
Bbx A G 16: 50,200,450 L865P probably damaging Het
C2cd3 T A 7: 100,432,223 I1024N Het
Cacna1e A T 1: 154,467,764 C1161S probably benign Het
Caskin2 A T 11: 115,811,904 V26E possibly damaging Het
Ccnb3 T G X: 7,008,174 D722A probably damaging Het
Cep135 C A 5: 76,633,703 Q846K probably benign Het
Cfap44 A T 16: 44,475,256 D1639V possibly damaging Het
Cfh G T 1: 140,086,373 R1238S probably damaging Het
Dctn1 A T 6: 83,192,853 D712V probably damaging Het
Ddx21 T C 10: 62,588,700 D574G probably damaging Het
Dlgap5 A G 14: 47,401,532 I443T probably damaging Het
Dusp7 G A 9: 106,373,767 V364I Het
Entpd1 G T 19: 40,726,164 R268L possibly damaging Het
Fam69b A G 2: 26,635,977 T308A probably benign Het
Fermt3 C T 19: 7,002,377 A463T probably benign Het
Frat2 T C 19: 41,847,667 D82G probably damaging Het
Git1 T A 11: 77,499,554 I75N probably damaging Het
Gpr171 T A 3: 59,098,067 I96F probably damaging Het
Gzmb G T 14: 56,260,388 R132S probably benign Het
Hecw1 C T 13: 14,372,023 R132H probably damaging Het
Hey1 T G 3: 8,664,591 S269R probably benign Het
Hgf T A 5: 16,560,981 N38K possibly damaging Het
Lag3 T C 6: 124,904,846 R467G probably damaging Het
Lama3 A T 18: 12,450,470 H705L probably damaging Het
Lce3f T G 3: 92,993,020 S49R unknown Het
Lrrc49 T C 9: 60,671,311 D250G probably damaging Het
Lzts3 T C 2: 130,635,328 K400R possibly damaging Het
Macc1 T C 12: 119,445,976 S160P probably benign Het
Macf1 T C 4: 123,382,400 T6155A possibly damaging Het
Mboat4 C T 8: 34,115,194 T34I probably benign Het
Nav3 T A 10: 109,705,663 Q1913L probably benign Het
Notch4 T C 17: 34,581,106 S1014P probably benign Het
Olfr67 T G 7: 103,787,795 I161L probably benign Het
Olfr93 T C 17: 37,151,232 T247A possibly damaging Het
Orc2 A C 1: 58,476,469 H293Q probably benign Het
Otoa A G 7: 121,094,622 Y75C probably damaging Het
Pate2 T A 9: 35,670,612 probably null Het
Phldb3 G A 7: 24,627,301 V585I probably damaging Het
Plk3 ACACTCAC ACAC 4: 117,131,893 probably benign Het
Pou2f1 A T 1: 165,895,034 N443K unknown Het
Prkci T A 3: 31,018,644 F66I probably damaging Het
Ptprz1 C T 6: 23,002,335 Q1475* probably null Het
Qars C T 9: 108,509,200 R143C probably damaging Het
Reln T C 5: 21,955,196 D2125G probably damaging Het
Rp1 A T 1: 4,346,913 D1325E probably damaging Het
Rpl36a-ps1 A T 14: 98,994,258 C15S probably damaging Het
Rsf1 CG CGACGGCGGGG 7: 97,579,908 probably benign Het
Scn9a A G 2: 66,484,400 I1658T probably damaging Het
Serinc1 C T 10: 57,519,481 G370S probably benign Het
Spef1 G T 2: 131,171,909 T197K probably damaging Het
Sptan1 G A 2: 30,030,585 V2363I probably damaging Het
Ssh2 T A 11: 77,455,276 C1362* probably null Het
Star T C 8: 25,812,804 V258A probably benign Het
Sympk T C 7: 19,044,948 I588T possibly damaging Het
Tas2r136 T C 6: 132,777,621 N181S probably damaging Het
Tbc1d4 A T 14: 101,487,516 V555E probably benign Het
Thegl A G 5: 77,016,606 Y152C probably damaging Het
Topaz1 G A 9: 122,796,163 V1438I probably benign Het
Trmt112 T A 19: 6,910,418 M45K Het
Tshr G A 12: 91,537,218 R310H probably damaging Het
Ulk4 G T 9: 121,261,922 P238Q probably damaging Het
Unc5a T C 13: 54,997,961 L312P possibly damaging Het
Urb1 T C 16: 90,769,402 D1499G possibly damaging Het
Ushbp1 A G 8: 71,391,009 S262P probably damaging Het
Vmn1r173 G A 7: 23,702,583 R81K probably benign Het
Vmn2r5 G A 3: 64,491,738 P607S probably benign Het
Vtn G T 11: 78,500,430 G223V probably damaging Het
Zfhx4 T C 3: 5,329,529 V1061A probably damaging Het
Zfp169 T C 13: 48,491,081 E190G unknown Het
Zfp616 T A 11: 74,085,454 C850S probably damaging Het
Other mutations in Olfr99
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01878:Olfr99 APN 17 37280000 missense possibly damaging 0.46
IGL02954:Olfr99 APN 17 37280304 missense probably damaging 1.00
R0533:Olfr99 UTSW 17 37280291 nonsense probably null
R1480:Olfr99 UTSW 17 37279745 missense probably benign 0.01
R2872:Olfr99 UTSW 17 37279976 missense possibly damaging 0.64
R2872:Olfr99 UTSW 17 37279976 missense possibly damaging 0.64
R3772:Olfr99 UTSW 17 37279854 missense probably benign 0.00
R3826:Olfr99 UTSW 17 37280249 missense probably damaging 1.00
R3827:Olfr99 UTSW 17 37280249 missense probably damaging 1.00
R3829:Olfr99 UTSW 17 37280249 missense probably damaging 1.00
R5210:Olfr99 UTSW 17 37279933 missense probably benign 0.13
R5361:Olfr99 UTSW 17 37279610 missense probably benign 0.02
R6213:Olfr99 UTSW 17 37280373 missense probably benign
R6399:Olfr99 UTSW 17 37279775 missense probably damaging 1.00
R6881:Olfr99 UTSW 17 37280309 missense probably benign 0.01
R7938:Olfr99 UTSW 17 37280100 missense probably benign 0.03
R8097:Olfr99 UTSW 17 37279927 nonsense probably null
R8125:Olfr99 UTSW 17 37280044 missense probably benign 0.01
R8218:Olfr99 UTSW 17 37279820 missense probably benign
R9050:Olfr99 UTSW 17 37279929 missense probably damaging 0.97
R9434:Olfr99 UTSW 17 37280363 missense probably benign 0.01
R9495:Olfr99 UTSW 17 37280495 start gained probably benign
R9514:Olfr99 UTSW 17 37280495 start gained probably benign
Z1176:Olfr99 UTSW 17 37279674 missense probably damaging 0.99
Z1177:Olfr99 UTSW 17 37280209 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGTAGCAAAGACTGTGCTGTAG -3'
(R):5'- GCTATCTGTCATCCACTGCG -3'

Sequencing Primer
(F):5'- CTGTGCTGTAGAAAAGGAGGACTAC -3'
(R):5'- GTCATCCACTGCGCTACTCAG -3'
Posted On 2022-01-20