Incidental Mutation 'R9126:Lama3'
ID 693285
Institutional Source Beutler Lab
Gene Symbol Lama3
Ensembl Gene ENSMUSG00000024421
Gene Name laminin, alpha 3
Synonyms [a]3B, nicein, 150kDa
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R9126 (G1)
Quality Score 225.009
Status Not validated
Chromosome 18
Chromosomal Location 12466876-12716070 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 12583527 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Leucine at position 705 (H705L)
Ref Sequence ENSEMBL: ENSMUSP00000089703 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092070]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000092070
AA Change: H705L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000089703
Gene: ENSMUSG00000024421
AA Change: H705L

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
LamNT 38 294 1.46e-153 SMART
EGF_Lam 296 350 1.39e-4 SMART
EGF_Lam 353 420 2.66e-10 SMART
EGF_Lam 423 464 3.51e-10 SMART
EGF_Lam 488 530 1.73e-9 SMART
EGF_Lam 533 576 3.81e-11 SMART
EGF_like 579 625 1.82e-1 SMART
EGF_Lam 628 678 5.15e-8 SMART
EGF_Lam 681 725 3.54e-6 SMART
low complexity region 768 781 N/A INTRINSIC
EGF_Lam 1263 1306 3.15e-12 SMART
EGF_Lam 1309 1350 6.3e-3 SMART
EGF_Lam 1353 1399 1.49e-13 SMART
EGF_Lam 1402 1450 8.18e-11 SMART
LamB 1509 1638 4.34e-55 SMART
Pfam:Laminin_EGF 1647 1681 7.9e-5 PFAM
EGF_Lam 1684 1728 2.66e-10 SMART
EGF_Lam 1731 1781 7.81e-8 SMART
Pfam:Laminin_I 1836 2102 2.7e-93 PFAM
low complexity region 2185 2200 N/A INTRINSIC
coiled coil region 2211 2238 N/A INTRINSIC
LamG 2406 2566 1.67e-2 SMART
LamG 2614 2742 1.72e-17 SMART
LamG 2785 2900 3.96e-17 SMART
LamG 3005 3133 1.12e-34 SMART
LamG 3175 3308 3.41e-30 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the laminin family of secreted molecules. Laminins are heterotrimeric molecules that consist of alpha, beta, and gamma subunits that assemble through a coiled-coil domain. Laminins are essential for formation and function of the basement membrane and have additional functions in regulating cell migration and mechanical signal transduction. This gene encodes an alpha subunit and is responsive to several epithelial-mesenchymal regulators including keratinocyte growth factor, epidermal growth factor and insulin-like growth factor. Mutations in this gene have been identified as the cause of Herlitz type junctional epidermolysis bullosa and laryngoonychocutaneous syndrome. Alternative splicing and alternative promoter usage result in multiple transcript variants. [provided by RefSeq, Dec 2014]
PHENOTYPE: Mice homozygous for a targeted null mutation develop a lethal blistering phenotype similar to human junctional epidermolysis bullosa, and die 2-3 days after birth from a failure to thrive. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam30 G T 3: 98,068,307 (GRCm39) V47L probably benign Het
Atm T C 9: 53,370,134 (GRCm39) K2323R probably benign Het
Bbx A G 16: 50,020,813 (GRCm39) L865P probably damaging Het
C2cd3 T A 7: 100,081,430 (GRCm39) I1024N Het
Cacna1e A T 1: 154,343,510 (GRCm39) C1161S probably benign Het
Caskin2 A T 11: 115,702,730 (GRCm39) V26E possibly damaging Het
Ccnb3 T G X: 6,874,413 (GRCm39) D722A probably damaging Het
Cep135 C A 5: 76,781,550 (GRCm39) Q846K probably benign Het
Cfap44 A T 16: 44,295,619 (GRCm39) D1639V possibly damaging Het
Cfh G T 1: 140,014,111 (GRCm39) R1238S probably damaging Het
Dctn1 A T 6: 83,169,835 (GRCm39) D712V probably damaging Het
Ddx21 T C 10: 62,424,479 (GRCm39) D574G probably damaging Het
Dele1 A G 18: 38,384,210 (GRCm39) T35A probably benign Het
Dipk1b A G 2: 26,525,989 (GRCm39) T308A probably benign Het
Dlgap5 A G 14: 47,638,989 (GRCm39) I443T probably damaging Het
Dusp7 G A 9: 106,250,966 (GRCm39) V364I Het
Entpd1 G T 19: 40,714,608 (GRCm39) R268L possibly damaging Het
Fermt3 C T 19: 6,979,745 (GRCm39) A463T probably benign Het
Frat2 T C 19: 41,836,106 (GRCm39) D82G probably damaging Het
Git1 T A 11: 77,390,380 (GRCm39) I75N probably damaging Het
Gpr171 T A 3: 59,005,488 (GRCm39) I96F probably damaging Het
Gzmb G T 14: 56,497,845 (GRCm39) R132S probably benign Het
Hecw1 C T 13: 14,546,608 (GRCm39) R132H probably damaging Het
Hey1 T G 3: 8,729,651 (GRCm39) S269R probably benign Het
Hgf T A 5: 16,765,979 (GRCm39) N38K possibly damaging Het
Lag3 T C 6: 124,881,809 (GRCm39) R467G probably damaging Het
Lce3f T G 3: 92,900,327 (GRCm39) S49R unknown Het
Lrrc49 T C 9: 60,578,594 (GRCm39) D250G probably damaging Het
Lzts3 T C 2: 130,477,248 (GRCm39) K400R possibly damaging Het
Macc1 T C 12: 119,409,711 (GRCm39) S160P probably benign Het
Macf1 T C 4: 123,276,193 (GRCm39) T6155A possibly damaging Het
Mboat4 C T 8: 34,582,348 (GRCm39) T34I probably benign Het
Nav3 T A 10: 109,541,524 (GRCm39) Q1913L probably benign Het
Notch4 T C 17: 34,800,080 (GRCm39) S1014P probably benign Het
Or1o4 T C 17: 37,590,745 (GRCm39) T189A probably benign Het
Or2h1b T C 17: 37,462,123 (GRCm39) T247A possibly damaging Het
Or52z1 T G 7: 103,437,002 (GRCm39) I161L probably benign Het
Orc2 A C 1: 58,515,628 (GRCm39) H293Q probably benign Het
Otoa A G 7: 120,693,845 (GRCm39) Y75C probably damaging Het
Pate2 T A 9: 35,581,908 (GRCm39) probably null Het
Phldb3 G A 7: 24,326,726 (GRCm39) V585I probably damaging Het
Plk3 ACACTCAC ACAC 4: 116,989,090 (GRCm39) probably benign Het
Pou2f1 A T 1: 165,722,603 (GRCm39) N443K unknown Het
Prkci T A 3: 31,072,793 (GRCm39) F66I probably damaging Het
Ptprz1 C T 6: 23,002,334 (GRCm39) Q1475* probably null Het
Qars1 C T 9: 108,386,399 (GRCm39) R143C probably damaging Het
Reln T C 5: 22,160,194 (GRCm39) D2125G probably damaging Het
Rp1 A T 1: 4,417,136 (GRCm39) D1325E probably damaging Het
Rpl36a-ps1 A T 14: 99,231,694 (GRCm39) C15S probably damaging Het
Rsf1 CG CGACGGCGGGG 7: 97,229,115 (GRCm39) probably benign Het
Scn9a A G 2: 66,314,744 (GRCm39) I1658T probably damaging Het
Serinc1 C T 10: 57,395,577 (GRCm39) G370S probably benign Het
Spef1 G T 2: 131,013,829 (GRCm39) T197K probably damaging Het
Spmap2l A G 5: 77,164,453 (GRCm39) Y152C probably damaging Het
Sptan1 G A 2: 29,920,597 (GRCm39) V2363I probably damaging Het
Ssh2 T A 11: 77,346,102 (GRCm39) C1362* probably null Het
Star T C 8: 26,302,832 (GRCm39) V258A probably benign Het
Sympk T C 7: 18,778,873 (GRCm39) I588T possibly damaging Het
Tas2r136 T C 6: 132,754,584 (GRCm39) N181S probably damaging Het
Tbc1d4 A T 14: 101,724,952 (GRCm39) V555E probably benign Het
Topaz1 G A 9: 122,625,228 (GRCm39) V1438I probably benign Het
Trmt112 T A 19: 6,887,786 (GRCm39) M45K Het
Tshr G A 12: 91,503,992 (GRCm39) R310H probably damaging Het
Ulk4 G T 9: 121,090,988 (GRCm39) P238Q probably damaging Het
Unc5a T C 13: 55,145,774 (GRCm39) L312P possibly damaging Het
Urb1 T C 16: 90,566,290 (GRCm39) D1499G possibly damaging Het
Ushbp1 A G 8: 71,843,653 (GRCm39) S262P probably damaging Het
Vmn1r173 G A 7: 23,402,008 (GRCm39) R81K probably benign Het
Vmn2r5 G A 3: 64,399,159 (GRCm39) P607S probably benign Het
Vtn G T 11: 78,391,256 (GRCm39) G223V probably damaging Het
Zfhx4 T C 3: 5,394,589 (GRCm39) V1061A probably damaging Het
Zfp169 T C 13: 48,644,557 (GRCm39) E190G unknown Het
Zfp616 T A 11: 73,976,280 (GRCm39) C850S probably damaging Het
Other mutations in Lama3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Lama3 APN 18 12,713,349 (GRCm39) missense probably benign
IGL00272:Lama3 APN 18 12,624,605 (GRCm39) missense probably damaging 1.00
IGL00335:Lama3 APN 18 12,582,645 (GRCm39) splice site probably benign
IGL00836:Lama3 APN 18 12,605,285 (GRCm39) missense probably benign 0.01
IGL01017:Lama3 APN 18 12,574,200 (GRCm39) critical splice donor site probably null
IGL01025:Lama3 APN 18 12,614,094 (GRCm39) missense probably benign 0.09
IGL01394:Lama3 APN 18 12,664,983 (GRCm39) missense probably null 0.39
IGL01545:Lama3 APN 18 12,574,188 (GRCm39) missense probably benign 0.01
IGL01685:Lama3 APN 18 12,586,937 (GRCm39) splice site probably benign
IGL01863:Lama3 APN 18 12,552,993 (GRCm39) splice site probably benign
IGL01869:Lama3 APN 18 12,657,820 (GRCm39) missense possibly damaging 0.94
IGL01894:Lama3 APN 18 12,705,121 (GRCm39) missense probably benign 0.09
IGL02027:Lama3 APN 18 12,649,570 (GRCm39) missense probably damaging 1.00
IGL02106:Lama3 APN 18 12,601,371 (GRCm39) missense probably damaging 0.98
IGL02307:Lama3 APN 18 12,714,840 (GRCm39) missense probably benign 0.09
IGL02342:Lama3 APN 18 12,624,533 (GRCm39) missense probably damaging 1.00
IGL02377:Lama3 APN 18 12,689,807 (GRCm39) missense possibly damaging 0.49
IGL02401:Lama3 APN 18 12,690,784 (GRCm39) missense probably benign 0.02
IGL02517:Lama3 APN 18 12,670,915 (GRCm39) critical splice donor site probably null
IGL02644:Lama3 APN 18 12,658,910 (GRCm39) missense probably benign 0.12
IGL02733:Lama3 APN 18 12,711,184 (GRCm39) missense probably damaging 0.99
IGL02932:Lama3 APN 18 12,661,858 (GRCm39) missense probably damaging 1.00
IGL03006:Lama3 APN 18 12,601,425 (GRCm39) splice site probably benign
IGL03038:Lama3 APN 18 12,552,307 (GRCm39) missense probably damaging 0.99
IGL03064:Lama3 APN 18 12,572,406 (GRCm39) missense possibly damaging 0.72
IGL03146:Lama3 APN 18 12,660,681 (GRCm39) missense possibly damaging 0.66
IGL03233:Lama3 APN 18 12,614,095 (GRCm39) missense probably damaging 1.00
IGL03255:Lama3 APN 18 12,672,760 (GRCm39) missense probably damaging 1.00
IGL03369:Lama3 APN 18 12,686,340 (GRCm39) missense probably benign 0.05
IGL03412:Lama3 APN 18 12,552,239 (GRCm39) missense probably damaging 0.99
IGL02980:Lama3 UTSW 18 12,686,288 (GRCm39) missense probably benign 0.01
IGL03014:Lama3 UTSW 18 12,673,024 (GRCm39) missense possibly damaging 0.95
R0007:Lama3 UTSW 18 12,630,938 (GRCm39) splice site probably benign
R0007:Lama3 UTSW 18 12,630,938 (GRCm39) splice site probably benign
R0050:Lama3 UTSW 18 12,537,160 (GRCm39) missense probably damaging 1.00
R0050:Lama3 UTSW 18 12,537,160 (GRCm39) missense probably damaging 1.00
R0063:Lama3 UTSW 18 12,661,762 (GRCm39) splice site probably benign
R0063:Lama3 UTSW 18 12,661,762 (GRCm39) splice site probably benign
R0106:Lama3 UTSW 18 12,537,039 (GRCm39) missense probably damaging 0.96
R0148:Lama3 UTSW 18 12,581,329 (GRCm39) missense probably damaging 1.00
R0165:Lama3 UTSW 18 12,657,867 (GRCm39) missense probably damaging 0.99
R0240:Lama3 UTSW 18 12,672,880 (GRCm39) splice site probably null
R0240:Lama3 UTSW 18 12,672,880 (GRCm39) splice site probably null
R0316:Lama3 UTSW 18 12,652,934 (GRCm39) missense probably benign 0.09
R0325:Lama3 UTSW 18 12,615,183 (GRCm39) missense probably damaging 1.00
R0365:Lama3 UTSW 18 12,640,064 (GRCm39) missense probably damaging 0.96
R0390:Lama3 UTSW 18 12,540,620 (GRCm39) missense probably benign 0.10
R0408:Lama3 UTSW 18 12,589,894 (GRCm39) missense probably benign
R0449:Lama3 UTSW 18 12,633,569 (GRCm39) splice site probably null
R0453:Lama3 UTSW 18 12,598,535 (GRCm39) missense possibly damaging 0.63
R0480:Lama3 UTSW 18 12,583,481 (GRCm39) missense possibly damaging 0.81
R0536:Lama3 UTSW 18 12,658,951 (GRCm39) missense probably damaging 1.00
R0545:Lama3 UTSW 18 12,694,758 (GRCm39) missense possibly damaging 0.90
R0567:Lama3 UTSW 18 12,682,309 (GRCm39) missense probably benign
R0605:Lama3 UTSW 18 12,640,006 (GRCm39) missense probably benign 0.02
R0617:Lama3 UTSW 18 12,552,315 (GRCm39) critical splice donor site probably null
R0629:Lama3 UTSW 18 12,552,302 (GRCm39) missense possibly damaging 0.79
R0671:Lama3 UTSW 18 12,610,647 (GRCm39) missense possibly damaging 0.80
R0730:Lama3 UTSW 18 12,589,907 (GRCm39) splice site probably benign
R1216:Lama3 UTSW 18 12,554,191 (GRCm39) splice site probably benign
R1356:Lama3 UTSW 18 12,633,634 (GRCm39) unclassified probably benign
R1386:Lama3 UTSW 18 12,610,427 (GRCm39) missense probably benign 0.04
R1424:Lama3 UTSW 18 12,653,048 (GRCm39) missense probably benign 0.13
R1426:Lama3 UTSW 18 12,614,155 (GRCm39) critical splice donor site probably null
R1437:Lama3 UTSW 18 12,682,284 (GRCm39) missense possibly damaging 0.46
R1468:Lama3 UTSW 18 12,574,164 (GRCm39) missense probably benign 0.00
R1468:Lama3 UTSW 18 12,574,164 (GRCm39) missense probably benign 0.00
R1472:Lama3 UTSW 18 12,615,102 (GRCm39) missense probably benign 0.23
R1557:Lama3 UTSW 18 12,646,788 (GRCm39) splice site probably benign
R1571:Lama3 UTSW 18 12,672,774 (GRCm39) missense probably damaging 0.98
R1599:Lama3 UTSW 18 12,583,457 (GRCm39) nonsense probably null
R1631:Lama3 UTSW 18 12,540,551 (GRCm39) missense probably damaging 1.00
R1647:Lama3 UTSW 18 12,665,256 (GRCm39) missense possibly damaging 0.90
R1648:Lama3 UTSW 18 12,665,256 (GRCm39) missense possibly damaging 0.90
R1719:Lama3 UTSW 18 12,612,929 (GRCm39) critical splice donor site probably null
R1757:Lama3 UTSW 18 12,598,556 (GRCm39) missense probably benign 0.10
R1766:Lama3 UTSW 18 12,535,119 (GRCm39) missense probably damaging 1.00
R1853:Lama3 UTSW 18 12,646,762 (GRCm39) missense possibly damaging 0.75
R1856:Lama3 UTSW 18 12,670,838 (GRCm39) nonsense probably null
R1909:Lama3 UTSW 18 12,714,855 (GRCm39) missense probably benign 0.19
R1913:Lama3 UTSW 18 12,628,336 (GRCm39) missense probably benign 0.15
R1975:Lama3 UTSW 18 12,586,920 (GRCm39) missense probably damaging 1.00
R2014:Lama3 UTSW 18 12,657,778 (GRCm39) splice site probably benign
R2059:Lama3 UTSW 18 12,661,390 (GRCm39) missense probably damaging 0.98
R2060:Lama3 UTSW 18 12,661,783 (GRCm39) missense probably benign 0.30
R2086:Lama3 UTSW 18 12,657,887 (GRCm39) missense probably benign 0.39
R2115:Lama3 UTSW 18 12,535,906 (GRCm39) missense possibly damaging 0.94
R2291:Lama3 UTSW 18 12,658,136 (GRCm39) missense probably damaging 0.98
R2860:Lama3 UTSW 18 12,586,807 (GRCm39) missense probably damaging 1.00
R2861:Lama3 UTSW 18 12,586,807 (GRCm39) missense probably damaging 1.00
R2862:Lama3 UTSW 18 12,586,807 (GRCm39) missense probably damaging 1.00
R3410:Lama3 UTSW 18 12,546,915 (GRCm39) critical splice donor site probably null
R3614:Lama3 UTSW 18 12,581,345 (GRCm39) missense probably benign 0.03
R3696:Lama3 UTSW 18 12,572,532 (GRCm39) splice site probably benign
R3752:Lama3 UTSW 18 12,640,086 (GRCm39) missense probably damaging 1.00
R3967:Lama3 UTSW 18 12,713,398 (GRCm39) missense probably damaging 1.00
R3968:Lama3 UTSW 18 12,713,398 (GRCm39) missense probably damaging 1.00
R3969:Lama3 UTSW 18 12,713,398 (GRCm39) missense probably damaging 1.00
R3970:Lama3 UTSW 18 12,713,398 (GRCm39) missense probably damaging 1.00
R4088:Lama3 UTSW 18 12,637,365 (GRCm39) nonsense probably null
R4118:Lama3 UTSW 18 12,583,488 (GRCm39) missense probably benign 0.01
R4222:Lama3 UTSW 18 12,583,460 (GRCm39) missense probably damaging 1.00
R4223:Lama3 UTSW 18 12,583,460 (GRCm39) missense probably damaging 1.00
R4224:Lama3 UTSW 18 12,583,460 (GRCm39) missense probably damaging 1.00
R4225:Lama3 UTSW 18 12,583,460 (GRCm39) missense probably damaging 1.00
R4367:Lama3 UTSW 18 12,646,747 (GRCm39) missense probably damaging 1.00
R4404:Lama3 UTSW 18 12,715,588 (GRCm39) missense probably benign 0.01
R4424:Lama3 UTSW 18 12,652,929 (GRCm39) nonsense probably null
R4483:Lama3 UTSW 18 12,682,310 (GRCm39) missense probably benign 0.32
R4484:Lama3 UTSW 18 12,614,145 (GRCm39) missense probably benign
R4516:Lama3 UTSW 18 12,628,415 (GRCm39) missense probably damaging 1.00
R4556:Lama3 UTSW 18 12,612,816 (GRCm39) missense possibly damaging 0.63
R4616:Lama3 UTSW 18 12,637,454 (GRCm39) critical splice donor site probably null
R4702:Lama3 UTSW 18 12,711,086 (GRCm39) nonsense probably null
R4704:Lama3 UTSW 18 12,686,280 (GRCm39) missense probably benign 0.08
R4750:Lama3 UTSW 18 12,637,416 (GRCm39) missense probably benign 0.25
R4753:Lama3 UTSW 18 12,615,141 (GRCm39) missense probably damaging 1.00
R4767:Lama3 UTSW 18 12,633,620 (GRCm39) missense probably benign 0.32
R4777:Lama3 UTSW 18 12,546,828 (GRCm39) missense probably damaging 1.00
R4782:Lama3 UTSW 18 12,544,627 (GRCm39) nonsense probably null
R4784:Lama3 UTSW 18 12,582,601 (GRCm39) missense probably benign 0.20
R4816:Lama3 UTSW 18 12,610,661 (GRCm39) missense possibly damaging 0.93
R4833:Lama3 UTSW 18 12,574,188 (GRCm39) missense probably benign 0.01
R4854:Lama3 UTSW 18 12,544,599 (GRCm39) missense probably benign 0.00
R4863:Lama3 UTSW 18 12,631,735 (GRCm39) intron probably benign
R4863:Lama3 UTSW 18 12,672,850 (GRCm39) missense probably damaging 0.99
R4953:Lama3 UTSW 18 12,581,362 (GRCm39) missense probably damaging 1.00
R4974:Lama3 UTSW 18 12,685,883 (GRCm39) missense probably damaging 0.98
R4996:Lama3 UTSW 18 12,651,800 (GRCm39) missense probably benign 0.24
R5049:Lama3 UTSW 18 12,715,668 (GRCm39) missense probably benign 0.19
R5057:Lama3 UTSW 18 12,665,005 (GRCm39) missense probably null 0.82
R5090:Lama3 UTSW 18 12,675,459 (GRCm39) missense possibly damaging 0.94
R5122:Lama3 UTSW 18 12,672,823 (GRCm39) missense possibly damaging 0.53
R5215:Lama3 UTSW 18 12,710,957 (GRCm39) missense probably damaging 1.00
R5245:Lama3 UTSW 18 12,552,950 (GRCm39) missense probably damaging 1.00
R5259:Lama3 UTSW 18 12,598,565 (GRCm39) missense probably damaging 1.00
R5320:Lama3 UTSW 18 12,685,912 (GRCm39) missense probably damaging 0.99
R5377:Lama3 UTSW 18 12,586,803 (GRCm39) missense probably damaging 0.99
R5432:Lama3 UTSW 18 12,705,123 (GRCm39) missense probably damaging 1.00
R5500:Lama3 UTSW 18 12,589,821 (GRCm39) missense possibly damaging 0.93
R5534:Lama3 UTSW 18 12,686,267 (GRCm39) missense probably benign 0.00
R5589:Lama3 UTSW 18 12,605,277 (GRCm39) missense possibly damaging 0.46
R5604:Lama3 UTSW 18 12,572,405 (GRCm39) missense probably benign
R5617:Lama3 UTSW 18 12,631,993 (GRCm39) intron probably benign
R5709:Lama3 UTSW 18 12,672,856 (GRCm39) missense probably damaging 1.00
R5965:Lama3 UTSW 18 12,562,944 (GRCm39) missense possibly damaging 0.67
R6042:Lama3 UTSW 18 12,707,311 (GRCm39) missense probably damaging 1.00
R6065:Lama3 UTSW 18 12,602,985 (GRCm39) missense possibly damaging 0.53
R6085:Lama3 UTSW 18 12,615,156 (GRCm39) missense probably benign 0.01
R6212:Lama3 UTSW 18 12,646,702 (GRCm39) missense probably damaging 1.00
R6268:Lama3 UTSW 18 12,657,794 (GRCm39) missense probably damaging 0.98
R6276:Lama3 UTSW 18 12,640,006 (GRCm39) missense probably benign 0.02
R6366:Lama3 UTSW 18 12,615,194 (GRCm39) missense probably damaging 1.00
R6393:Lama3 UTSW 18 12,612,813 (GRCm39) missense probably benign 0.44
R6493:Lama3 UTSW 18 12,615,205 (GRCm39) critical splice donor site probably null
R6505:Lama3 UTSW 18 12,628,405 (GRCm39) missense probably benign 0.02
R6563:Lama3 UTSW 18 12,670,823 (GRCm39) missense probably damaging 1.00
R6582:Lama3 UTSW 18 12,710,897 (GRCm39) missense probably damaging 1.00
R6585:Lama3 UTSW 18 12,552,314 (GRCm39) critical splice donor site probably null
R6609:Lama3 UTSW 18 12,646,735 (GRCm39) missense probably damaging 0.99
R6656:Lama3 UTSW 18 12,682,283 (GRCm39) missense possibly damaging 0.66
R6833:Lama3 UTSW 18 12,624,605 (GRCm39) missense probably damaging 1.00
R6834:Lama3 UTSW 18 12,624,605 (GRCm39) missense probably damaging 1.00
R7019:Lama3 UTSW 18 12,661,475 (GRCm39) missense probably damaging 0.97
R7026:Lama3 UTSW 18 12,649,605 (GRCm39) missense probably damaging 0.98
R7088:Lama3 UTSW 18 12,715,602 (GRCm39) missense possibly damaging 0.90
R7100:Lama3 UTSW 18 12,715,701 (GRCm39) missense possibly damaging 0.80
R7102:Lama3 UTSW 18 12,685,870 (GRCm39) missense possibly damaging 0.66
R7103:Lama3 UTSW 18 12,664,936 (GRCm39) missense probably benign 0.00
R7121:Lama3 UTSW 18 12,595,839 (GRCm39) missense probably benign 0.06
R7133:Lama3 UTSW 18 12,672,843 (GRCm39) missense probably benign 0.05
R7150:Lama3 UTSW 18 12,601,346 (GRCm39) missense probably damaging 1.00
R7158:Lama3 UTSW 18 12,589,869 (GRCm39) missense probably benign 0.20
R7170:Lama3 UTSW 18 12,537,133 (GRCm39) missense probably benign 0.26
R7216:Lama3 UTSW 18 12,563,057 (GRCm39) missense probably damaging 1.00
R7223:Lama3 UTSW 18 12,715,665 (GRCm39) missense possibly damaging 0.53
R7243:Lama3 UTSW 18 12,552,902 (GRCm39) missense probably damaging 1.00
R7282:Lama3 UTSW 18 12,572,449 (GRCm39) missense probably damaging 0.99
R7337:Lama3 UTSW 18 12,640,097 (GRCm39) splice site probably null
R7442:Lama3 UTSW 18 12,605,238 (GRCm39) critical splice acceptor site probably null
R7487:Lama3 UTSW 18 12,552,294 (GRCm39) missense probably benign
R7604:Lama3 UTSW 18 12,633,550 (GRCm39) missense possibly damaging 0.93
R7609:Lama3 UTSW 18 12,664,891 (GRCm39) critical splice acceptor site probably null
R7650:Lama3 UTSW 18 12,670,895 (GRCm39) missense probably benign 0.01
R7894:Lama3 UTSW 18 12,595,864 (GRCm39) missense probably benign 0.07
R7975:Lama3 UTSW 18 12,670,796 (GRCm39) missense probably damaging 1.00
R8099:Lama3 UTSW 18 12,667,120 (GRCm39) missense probably damaging 0.97
R8168:Lama3 UTSW 18 12,639,999 (GRCm39) missense probably null
R8219:Lama3 UTSW 18 12,572,417 (GRCm39) missense probably benign 0.07
R8227:Lama3 UTSW 18 12,540,608 (GRCm39) missense probably benign
R8229:Lama3 UTSW 18 12,540,608 (GRCm39) missense probably benign
R8298:Lama3 UTSW 18 12,658,910 (GRCm39) missense probably benign 0.12
R8351:Lama3 UTSW 18 12,673,670 (GRCm39) missense probably damaging 1.00
R8364:Lama3 UTSW 18 12,661,404 (GRCm39) missense probably damaging 0.99
R8463:Lama3 UTSW 18 12,582,896 (GRCm39) missense probably damaging 0.96
R8515:Lama3 UTSW 18 12,544,688 (GRCm39) missense probably null 0.01
R8784:Lama3 UTSW 18 12,554,212 (GRCm39) missense probably benign
R8799:Lama3 UTSW 18 12,624,000 (GRCm39) missense probably damaging 0.96
R8874:Lama3 UTSW 18 12,582,643 (GRCm39) critical splice donor site probably null
R8938:Lama3 UTSW 18 12,689,762 (GRCm39) missense probably damaging 1.00
R8967:Lama3 UTSW 18 12,665,096 (GRCm39) missense possibly damaging 0.46
R9039:Lama3 UTSW 18 12,614,120 (GRCm39) nonsense probably null
R9200:Lama3 UTSW 18 12,605,297 (GRCm39) missense probably benign 0.00
R9203:Lama3 UTSW 18 12,595,869 (GRCm39) missense probably benign 0.04
R9246:Lama3 UTSW 18 12,710,959 (GRCm39) missense probably damaging 0.99
R9284:Lama3 UTSW 18 12,583,541 (GRCm39) nonsense probably null
R9553:Lama3 UTSW 18 12,563,019 (GRCm39) missense probably damaging 1.00
R9716:Lama3 UTSW 18 12,583,460 (GRCm39) missense probably damaging 1.00
R9734:Lama3 UTSW 18 12,682,320 (GRCm39) missense possibly damaging 0.94
X0019:Lama3 UTSW 18 12,715,631 (GRCm39) missense possibly damaging 0.94
Z1177:Lama3 UTSW 18 12,562,936 (GRCm39) critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- AGAAGCAGCCCACACAGTTG -3'
(R):5'- ACTGTCCACTTTAGGCTGTG -3'

Sequencing Primer
(F):5'- CACACAGTTGTCTTCTCTTGTAGAGG -3'
(R):5'- GTAGCTTATGCCACAGAACTGGTC -3'
Posted On 2022-01-20