Incidental Mutation 'R9127:Abcc6'
ID 693324
Institutional Source Beutler Lab
Gene Symbol Abcc6
Ensembl Gene ENSMUSG00000030834
Gene Name ATP-binding cassette, sub-family C (CFTR/MRP), member 6
Synonyms Mrp6, DCC, Dyscalc1
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.692) question?
Stock # R9127 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 45967555-46030302 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 45979760 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 1354 (N1354S)
Ref Sequence ENSEMBL: ENSMUSP00000002850 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002850]
AlphaFold Q9R1S7
Predicted Effect probably damaging
Transcript: ENSMUST00000002850
AA Change: N1354S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000002850
Gene: ENSMUSG00000030834
AA Change: N1354S

DomainStartEndE-ValueType
transmembrane domain 44 61 N/A INTRINSIC
transmembrane domain 81 100 N/A INTRINSIC
transmembrane domain 110 129 N/A INTRINSIC
transmembrane domain 142 161 N/A INTRINSIC
transmembrane domain 171 193 N/A INTRINSIC
Pfam:ABC_membrane 309 580 3.5e-29 PFAM
AAA 653 828 1.19e-9 SMART
low complexity region 871 885 N/A INTRINSIC
Pfam:ABC_membrane 942 1211 2.5e-32 PFAM
AAA 1286 1473 1.71e-10 SMART
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MRP subfamily which is involved in multi-drug resistance. The specific function of this protein is unknown; however, a similar rat protein has been identified as the major canalicular bile salt export pump of liver. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display patchy mineralization which may include the capsule surrounding the sinuses of vibrissae, medium sized arteries, skin, retina, kidney, and interscapular brown fat. Strain differences at this locus may lead to altered susceptibility to cardiac calcinosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1190007I07Rik A T 10: 82,622,754 M21K probably benign Het
1700014D04Rik A G 13: 59,743,014 S331P probably benign Het
1700029J07Rik T G 8: 45,962,366 D201A probably benign Het
Abca13 T G 11: 9,292,080 D1314E probably benign Het
Abcb1a A T 5: 8,674,707 R47W probably benign Het
Abracl T C 10: 18,011,696 Y61C probably damaging Het
Adamtsl1 A G 4: 86,289,790 T633A probably benign Het
Ago4 A T 4: 126,507,111 M647K probably damaging Het
Akap7 G T 10: 25,279,778 S72R unknown Het
Arhgef12 A G 9: 42,974,574 L1251S possibly damaging Het
Astn2 A T 4: 66,403,927 V145E unknown Het
Atxn2l A T 7: 126,498,221 S304R probably damaging Het
Cd226 A T 18: 89,269,031 I318F probably damaging Het
Cep250 C T 2: 155,970,122 A446V unknown Het
Chtf8 A G 8: 106,887,008 V18A probably benign Het
Cit G T 5: 115,936,837 E683* probably null Het
Ckmt2 T C 13: 91,859,218 R286G probably damaging Het
Clec4a2 T A 6: 123,139,259 W128R probably damaging Het
Clec4n T G 6: 123,235,488 S88A probably damaging Het
Cndp2 G A 18: 84,680,996 A48V probably benign Het
Csmd1 T C 8: 16,223,272 T849A probably benign Het
Cts3 A T 13: 61,567,421 Y199* probably null Het
Dag1 A T 9: 108,208,535 L469* probably null Het
Dclre1c T C 2: 3,438,088 V225A Het
Dedd A G 1: 171,338,841 D115G probably damaging Het
Dnah8 CGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTT CGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTT 17: 30,760,867 probably null Het
E330014E10Rik A G 5: 95,803,764 Y470C probably damaging Het
Eif2ak3 T A 6: 70,883,720 W427R probably damaging Het
Fbln2 T A 6: 91,233,491 V139D probably damaging Het
Fbn1 A T 2: 125,382,065 M588K possibly damaging Het
Gm11639 T A 11: 104,850,581 V2166D probably benign Het
Gm17019 A T 5: 15,031,099 Y109* probably null Het
Gm32742 T A 9: 51,144,715 N1255Y probably damaging Het
Gm5431 T A 11: 48,888,773 K441* probably null Het
Golga2 A G 2: 32,306,067 D898G Het
Gramd4 G A 15: 86,091,324 R39H probably benign Het
Gucy1a2 A G 9: 3,634,553 N199S probably damaging Het
Heyl G A 4: 123,246,092 R148H probably damaging Het
Ifi208 A T 1: 173,695,834 M557L probably benign Het
Igf2r A G 17: 12,739,351 V145A probably damaging Het
Ighv1-4 A T 12: 114,487,259 Y76* probably null Het
Ikzf4 T C 10: 128,632,618 D664G unknown Het
Il1a T A 2: 129,304,795 Y126F possibly damaging Het
Lmf2 C A 15: 89,355,568 probably benign Het
Lyst T C 13: 13,634,242 S166P probably damaging Het
Mgat5 A C 1: 127,366,460 T180P probably benign Het
Mical2 A C 7: 112,271,382 K26T possibly damaging Het
Mov10 G T 3: 104,804,343 Y209* probably null Het
Nol8 T C 13: 49,661,999 Y528H probably benign Het
Numa1 T A 7: 101,992,662 S106T possibly damaging Het
Olfr1232 G A 2: 89,326,130 Q17* probably null Het
Olfr1461 A G 19: 13,165,032 N6S probably damaging Het
Olfr396-ps1 A T 11: 73,928,341 E39V probably damaging Het
Olfr845 A G 9: 19,338,730 H90R probably benign Het
Pcdhb14 A G 18: 37,449,038 N399S probably damaging Het
Plcl2 T A 17: 50,611,004 S944T probably benign Het
Pml A T 9: 58,220,377 I695N probably benign Het
Ppard G T 17: 28,286,375 R12L unknown Het
Ppip5k1 C T 2: 121,327,644 probably null Het
Ppp1r3g T C 13: 35,968,638 S14P probably benign Het
Prrc2b C A 2: 32,213,752 R1081S probably damaging Het
Rasgrp2 A T 19: 6,404,408 E160D possibly damaging Het
Rb1cc1 G A 1: 6,262,849 V1331I probably damaging Het
Rnd3 A T 2: 51,132,401 S210T probably benign Het
Scaf11 T C 15: 96,414,883 T1426A probably benign Het
Sin3b C T 8: 72,733,406 T207I possibly damaging Het
Slc26a7 A T 4: 14,593,873 Y81N probably damaging Het
Slc28a3 C T 13: 58,576,767 M224I probably benign Het
Slc30a1 T C 1: 191,907,230 I75T probably damaging Het
Slco2a1 T A 9: 103,068,044 L206Q probably damaging Het
Sptbn1 A G 11: 30,154,356 V116A probably damaging Het
Syngap1 G A 17: 26,962,121 D1008N probably damaging Het
Syt11 T C 3: 88,762,336 D83G probably benign Het
Syt14 G A 1: 192,901,823 T428I probably damaging Het
Taf15 T A 11: 83,504,259 Y338* probably null Het
Tfap4 A T 16: 4,547,319 M253K possibly damaging Het
Tnr T C 1: 159,886,110 S703P possibly damaging Het
Trrap G A 5: 144,831,020 D2577N probably benign Het
Wdr20 C T 12: 110,793,163 S161L possibly damaging Het
Zfp503 C A 14: 21,987,350 V62L probably benign Het
Other mutations in Abcc6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01589:Abcc6 APN 7 46002672 splice site probably benign
IGL01731:Abcc6 APN 7 46002610 missense possibly damaging 0.71
IGL01743:Abcc6 APN 7 45996814 missense probably benign 0.02
IGL01757:Abcc6 APN 7 45990281 splice site probably benign
IGL01895:Abcc6 APN 7 46029058 missense possibly damaging 0.88
IGL01942:Abcc6 APN 7 45986573 missense possibly damaging 0.89
IGL02251:Abcc6 APN 7 45977416 missense probably damaging 1.00
IGL02277:Abcc6 APN 7 46001061 missense probably benign 0.00
IGL02548:Abcc6 APN 7 46005262 missense probably damaging 0.98
IGL03063:Abcc6 APN 7 46016432 missense probably benign
IGL03092:Abcc6 APN 7 45986470 missense probably damaging 1.00
IGL03251:Abcc6 APN 7 45982237 unclassified probably benign
R0057:Abcc6 UTSW 7 46020143 missense probably benign 0.03
R0944:Abcc6 UTSW 7 46015505 missense possibly damaging 0.81
R1019:Abcc6 UTSW 7 46014107 missense possibly damaging 0.77
R1183:Abcc6 UTSW 7 45985253 missense probably damaging 0.99
R1543:Abcc6 UTSW 7 46016504 missense probably benign 0.01
R1550:Abcc6 UTSW 7 46005244 missense probably benign 0.25
R1725:Abcc6 UTSW 7 45992357 missense possibly damaging 0.76
R1907:Abcc6 UTSW 7 46014169 missense probably benign 0.04
R1908:Abcc6 UTSW 7 46020134 splice site probably null
R1909:Abcc6 UTSW 7 46020134 splice site probably null
R2138:Abcc6 UTSW 7 45981051 missense probably damaging 1.00
R2145:Abcc6 UTSW 7 45998741 missense probably benign 0.01
R2402:Abcc6 UTSW 7 46015575 missense probably benign 0.04
R3983:Abcc6 UTSW 7 45995289 missense probably benign
R4013:Abcc6 UTSW 7 46018680 missense probably benign 0.01
R4051:Abcc6 UTSW 7 45986563 missense probably damaging 1.00
R4052:Abcc6 UTSW 7 45986563 missense probably damaging 1.00
R4208:Abcc6 UTSW 7 45986563 missense probably damaging 1.00
R4362:Abcc6 UTSW 7 45998832 splice site probably benign
R4385:Abcc6 UTSW 7 45995328 missense possibly damaging 0.93
R4399:Abcc6 UTSW 7 46002607 missense probably benign
R4479:Abcc6 UTSW 7 46005239 missense possibly damaging 0.60
R4480:Abcc6 UTSW 7 46005239 missense possibly damaging 0.60
R4780:Abcc6 UTSW 7 45996691 missense probably benign
R4791:Abcc6 UTSW 7 45982160 missense probably benign 0.00
R4895:Abcc6 UTSW 7 45980990 missense possibly damaging 0.95
R4898:Abcc6 UTSW 7 45989687 missense probably damaging 0.96
R4905:Abcc6 UTSW 7 45995225 missense probably benign
R4941:Abcc6 UTSW 7 46012523 missense probably benign 0.00
R5040:Abcc6 UTSW 7 46020154 missense probably benign 0.04
R5128:Abcc6 UTSW 7 45989646 missense probably benign 0.00
R5284:Abcc6 UTSW 7 45981059 missense probably benign 0.05
R5328:Abcc6 UTSW 7 45992311 missense probably benign 0.01
R5459:Abcc6 UTSW 7 45982183 missense probably benign 0.00
R5543:Abcc6 UTSW 7 45989536 critical splice donor site probably null
R6178:Abcc6 UTSW 7 46029044 missense probably benign
R6228:Abcc6 UTSW 7 46030256 missense probably benign 0.02
R6532:Abcc6 UTSW 7 45977379 missense probably damaging 1.00
R6605:Abcc6 UTSW 7 45981057 missense probably damaging 1.00
R7000:Abcc6 UTSW 7 46005522 missense possibly damaging 0.60
R7067:Abcc6 UTSW 7 46018690 missense probably benign
R7553:Abcc6 UTSW 7 45999121 missense probably damaging 1.00
R7597:Abcc6 UTSW 7 45995237 missense probably damaging 1.00
R7718:Abcc6 UTSW 7 45977392 missense possibly damaging 0.91
R7781:Abcc6 UTSW 7 46005606 missense probably damaging 1.00
R7798:Abcc6 UTSW 7 45976853 nonsense probably null
R7896:Abcc6 UTSW 7 45977379 missense probably damaging 1.00
R8098:Abcc6 UTSW 7 45996665 missense probably damaging 1.00
R8443:Abcc6 UTSW 7 45980025 missense probably damaging 1.00
R8773:Abcc6 UTSW 7 45985145 missense probably benign
R8784:Abcc6 UTSW 7 46002601 missense probably benign
R8802:Abcc6 UTSW 7 46008859 missense probably damaging 0.99
R8807:Abcc6 UTSW 7 45999007 missense possibly damaging 0.67
R9006:Abcc6 UTSW 7 46016396 missense probably benign 0.00
X0065:Abcc6 UTSW 7 46020197 missense probably damaging 0.99
Z1176:Abcc6 UTSW 7 45979734 missense probably damaging 1.00
Z1176:Abcc6 UTSW 7 45992306 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AGTCTAGGCTAGGTTTCGCC -3'
(R):5'- ATCGATGGGGTCCCTATCAC -3'

Sequencing Primer
(F):5'- TTTCGCCATGGGAAAAAGATC -3'
(R):5'- GGTCCCTATCACCCATGTGG -3'
Posted On 2022-01-20