Incidental Mutation 'R9128:Sec24d'
ID 693387
Institutional Source Beutler Lab
Gene Symbol Sec24d
Ensembl Gene ENSMUSG00000039234
Gene Name Sec24 related gene family, member D (S. cerevisiae)
Synonyms 2310020L09Rik, LOC383951
MMRRC Submission 068927-MU
Accession Numbers

Genbank: NM_027135; MGI: 1916858
Essential gene? Essential (E-score: 1.000) question?
Stock # R9128 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 123267455-123365641 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 123294161 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 224 (T224A)
Ref Sequence ENSEMBL: ENSMUSP00000035823 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047923]
AlphaFold Q6NXL1
Predicted Effect probably benign
Transcript: ENSMUST00000047923
AA Change: T224A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000035823
Gene: ENSMUSG00000039234
AA Change: T224A

DomainStartEndE-ValueType
low complexity region 46 71 N/A INTRINSIC
low complexity region 75 87 N/A INTRINSIC
low complexity region 136 160 N/A INTRINSIC
low complexity region 197 222 N/A INTRINSIC
low complexity region 238 256 N/A INTRINSIC
Pfam:zf-Sec23_Sec24 360 398 1.8e-16 PFAM
Pfam:Sec23_trunk 437 681 3.6e-88 PFAM
Pfam:Sec23_BS 686 770 2e-20 PFAM
Pfam:Sec23_helical 783 884 1e-27 PFAM
Pfam:Gelsolin 899 974 4.2e-12 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the SEC24 subfamily of the SEC23/SEC24 family, which is involved in vesicle trafficking. The encoded protein has similarity to yeast Sec24p component of COPII. COPII is the coat protein complex responsible for vesicle budding from the ER. This gene product is implicated in the shaping of the vesicle, and also in cargo selection and concentration. Mutations in this gene have been associated with Cole-Carpenter syndrome, a disorder affecting bone formation, resulting in craniofacial malformations and bones that break easily. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit early embryonic lethality. A hypomorphic gene trap allele results in lethality during organogenesis. [provided by MGI curators]
Allele List at MGI

All alleles(5) : Gene trapped(5)
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 T C 10: 80,002,518 V542A possibly damaging Het
Abhd8 G T 8: 71,461,745 R80S probably benign Het
Actc1 T C 2: 114,050,465 Y93C possibly damaging Het
Actn4 G T 7: 28,894,504 D859E possibly damaging Het
Adcy2 C T 13: 68,625,808 G1039R probably damaging Het
Als2 A G 1: 59,180,550 M1202T probably benign Het
Aste1 T A 9: 105,396,709 Y49* probably null Het
Atp8b4 T C 2: 126,392,830 D422G probably benign Het
Bag6 T A 17: 35,144,712 S791T probably damaging Het
Bivm T A 1: 44,128,789 W222R probably null Het
Bod1l A C 5: 41,788,923 V3003G probably benign Het
Bsn T C 9: 108,116,150 D801G probably benign Het
Ccdc14 G A 16: 34,706,789 D403N probably damaging Het
Cenpj T A 14: 56,542,862 E964V probably damaging Het
Cep250 C T 2: 155,970,122 A446V unknown Het
Clca3a1 G A 3: 144,758,034 R161W probably damaging Het
Dcxr A T 11: 120,726,546 V57E Het
Dnah17 T G 11: 118,046,178 N3400T possibly damaging Het
Dnaja3 C T 16: 4,702,300 T444I possibly damaging Het
Dopey1 T C 9: 86,513,155 S772P probably benign Het
Ednrb T C 14: 103,843,092 N129D probably damaging Het
Ep300 T A 15: 81,649,745 M2001K unknown Het
Fam3b A G 16: 97,501,000 I8T probably benign Het
Fam98c A T 7: 29,154,690 S85T Het
Fat1 G A 8: 45,009,841 V1232I probably benign Het
Fzd3 T A 14: 65,212,177 Y484F probably damaging Het
Gm13023 T A 4: 143,793,608 S141T probably benign Het
H3f3a T C 1: 180,803,095 I131M possibly damaging Het
Ifi206 A T 1: 173,471,456 D861E unknown Het
Ihh T C 1: 74,946,339 Y329C probably damaging Het
Jak2 A G 19: 29,301,062 N909D probably damaging Het
Krtap12-1 C A 10: 77,720,789 C55* probably null Het
Mical2 A C 7: 112,271,382 K26T possibly damaging Het
Mpp5 A G 12: 78,797,058 E12G probably benign Het
Mreg T C 1: 72,192,057 T81A probably benign Het
Muc16 T C 9: 18,647,582 T2472A unknown Het
Nanos3 A T 8: 84,176,451 D27E probably benign Het
Nox3 T G 17: 3,669,861 S350R probably damaging Het
Olfr1049 T A 2: 86,255,678 N5I probably damaging Het
Olfr734 A G 14: 50,320,757 V26A probably benign Het
Pafah2 C T 4: 134,419,970 T310M probably damaging Het
Pianp A G 6: 125,000,695 I185V probably benign Het
Pja2 T C 17: 64,309,475 T142A probably benign Het
Poln G A 5: 34,014,314 P747L probably damaging Het
Rdx T A 9: 52,064,879 L39* probably null Het
Rnf146 A G 10: 29,347,543 W116R probably damaging Het
Rsf1 G GACGGCGGCT 7: 97,579,909 probably benign Het
Serpinb9 T A 13: 33,006,703 I54K possibly damaging Het
Slc25a13 A T 6: 6,109,987 L324Q probably null Het
Slc9c1 T C 16: 45,580,127 L700P probably benign Het
Snta1 T C 2: 154,380,936 K289R probably benign Het
Sppl2a A G 2: 126,923,473 F243S probably damaging Het
Syne1 T C 10: 5,108,556 E7319G probably benign Het
Taf5l G A 8: 124,003,275 P225L probably benign Het
Tet2 A T 3: 133,469,613 N1324K possibly damaging Het
Usp5 A T 6: 124,823,451 probably null Het
Vmn2r124 G T 17: 18,074,177 R842L probably benign Het
Vps16 A G 2: 130,424,399 D2G possibly damaging Het
Vwf T C 6: 125,642,730 L1457P Het
Xpo1 A G 11: 23,285,058 T576A probably damaging Het
Zdhhc6 A T 19: 55,313,248 Y100* probably null Het
Zfp534 T A 4: 147,675,625 R196* probably null Het
Zfp710 C T 7: 80,081,374 R100W probably damaging Het
Zfp750 T C 11: 121,513,848 K67R probably benign Het
Zmynd10 T C 9: 107,549,127 S158P Het
Zmynd8 A T 2: 165,858,138 M1K probably null Het
Other mutations in Sec24d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01420:Sec24d APN 3 123350009 missense probably benign 0.00
IGL01621:Sec24d APN 3 123294158 critical splice acceptor site probably null
IGL01866:Sec24d APN 3 123293595 nonsense probably null
IGL02064:Sec24d APN 3 123343814 splice site probably benign
IGL02125:Sec24d APN 3 123358958 missense probably damaging 1.00
IGL02173:Sec24d APN 3 123353681 missense probably damaging 1.00
IGL03239:Sec24d APN 3 123336489 missense probably benign 0.00
Scanty UTSW 3 123354947 missense probably damaging 1.00
3-1:Sec24d UTSW 3 123353630 missense possibly damaging 0.94
PIT4531001:Sec24d UTSW 3 123343178 missense probably damaging 1.00
R0008:Sec24d UTSW 3 123350876 splice site probably benign
R0838:Sec24d UTSW 3 123305836 missense probably benign 0.08
R1775:Sec24d UTSW 3 123336517 missense probably damaging 1.00
R1895:Sec24d UTSW 3 123353394 missense probably benign 0.04
R1946:Sec24d UTSW 3 123353394 missense probably benign 0.04
R2238:Sec24d UTSW 3 123349894 splice site probably null
R2504:Sec24d UTSW 3 123353606 missense possibly damaging 0.69
R2846:Sec24d UTSW 3 123350746 missense probably damaging 0.98
R2895:Sec24d UTSW 3 123343151 missense probably damaging 1.00
R3428:Sec24d UTSW 3 123343923 splice site probably benign
R4573:Sec24d UTSW 3 123358870 missense probably damaging 1.00
R4668:Sec24d UTSW 3 123355774 missense probably damaging 0.98
R4706:Sec24d UTSW 3 123355778 missense possibly damaging 0.80
R4896:Sec24d UTSW 3 123354947 missense probably damaging 1.00
R4982:Sec24d UTSW 3 123299606 missense probably benign 0.29
R5030:Sec24d UTSW 3 123358901 missense probably damaging 0.98
R5041:Sec24d UTSW 3 123294231 missense probably damaging 0.96
R5078:Sec24d UTSW 3 123290552 missense probably benign 0.00
R5108:Sec24d UTSW 3 123305785 splice site probably null
R5174:Sec24d UTSW 3 123364926 missense probably damaging 0.99
R5661:Sec24d UTSW 3 123343085 missense probably damaging 1.00
R5661:Sec24d UTSW 3 123343142 missense possibly damaging 0.95
R5775:Sec24d UTSW 3 123290460 missense probably benign 0.00
R5859:Sec24d UTSW 3 123279312 unclassified probably benign
R5944:Sec24d UTSW 3 123293581 missense probably benign 0.01
R6053:Sec24d UTSW 3 123279222 nonsense probably null
R6515:Sec24d UTSW 3 123343070 missense possibly damaging 0.92
R6552:Sec24d UTSW 3 123290552 missense probably benign 0.00
R6557:Sec24d UTSW 3 123343087 missense probably damaging 1.00
R6593:Sec24d UTSW 3 123353412 missense probably damaging 1.00
R6594:Sec24d UTSW 3 123293763 missense probably damaging 1.00
R6842:Sec24d UTSW 3 123343219 missense probably benign 0.00
R7072:Sec24d UTSW 3 123330351 missense probably damaging 1.00
R7481:Sec24d UTSW 3 123350763 missense probably damaging 1.00
R7554:Sec24d UTSW 3 123355774 missense probably damaging 1.00
R8270:Sec24d UTSW 3 123305886 missense possibly damaging 0.90
R8481:Sec24d UTSW 3 123353424 missense probably damaging 1.00
R8713:Sec24d UTSW 3 123343892 missense probably damaging 1.00
R8872:Sec24d UTSW 3 123354936 splice site probably benign
R8922:Sec24d UTSW 3 123350839 missense probably damaging 1.00
R8974:Sec24d UTSW 3 123305849 missense probably damaging 1.00
R9015:Sec24d UTSW 3 123327638 missense probably benign 0.43
R9050:Sec24d UTSW 3 123350725 missense probably benign 0.00
R9065:Sec24d UTSW 3 123355803 missense probably damaging 1.00
R9447:Sec24d UTSW 3 123290513 missense probably benign 0.00
R9701:Sec24d UTSW 3 123269672 missense probably damaging 1.00
R9758:Sec24d UTSW 3 123343154 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCTGGATAGCATCAGAAGGGC -3'
(R):5'- CCTGGAGGACTCAATGCTAAC -3'

Sequencing Primer
(F):5'- TAGCATCAGAAGGGCAAGTTAAAC -3'
(R):5'- CCTGGAGGACTCAATGCTAACAAATG -3'
Posted On 2022-01-20