Incidental Mutation 'R9128:Rdx'
ID 693409
Institutional Source Beutler Lab
Gene Symbol Rdx
Ensembl Gene ENSMUSG00000032050
Gene Name radixin
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9128 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 52047173-52088735 bp(+) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) T to A at 52064879 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Stop codon at position 39 (L39*)
Ref Sequence ENSEMBL: ENSMUSP00000000590 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000590] [ENSMUST00000061352] [ENSMUST00000163153]
AlphaFold P26043
Predicted Effect probably null
Transcript: ENSMUST00000000590
AA Change: L39*
SMART Domains Protein: ENSMUSP00000000590
Gene: ENSMUSG00000032050
AA Change: L39*

DomainStartEndE-ValueType
B41 1 206 4.99e-82 SMART
FERM_C 210 299 1.43e-35 SMART
Pfam:ERM 338 583 6e-85 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000061352
AA Change: L39*
SMART Domains Protein: ENSMUSP00000055303
Gene: ENSMUSG00000032050
AA Change: L39*

DomainStartEndE-ValueType
B41 1 206 4.99e-82 SMART
FERM_C 210 299 1.43e-35 SMART
coiled coil region 300 365 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000163153
AA Change: L39*
SMART Domains Protein: ENSMUSP00000128249
Gene: ENSMUSG00000032050
AA Change: L39*

DomainStartEndE-ValueType
B41 1 206 4.99e-82 SMART
FERM_C 210 299 1.43e-35 SMART
Pfam:ERM 338 583 3.4e-78 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Radixin is a cytoskeletal protein that may be important in linking actin to the plasma membrane. It is highly similar in sequence to both ezrin and moesin. The radixin gene has been localized by fluorescence in situ hybridization to 11q23. A truncated version representing a pseudogene (RDXP2) was assigned to Xp21.3. Another pseudogene that seemed to lack introns (RDXP1) was mapped to 11p by Southern and PCR analyses. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2012]
PHENOTYPE: Mice homozygous for a targeted mutation display mild degenerative changes in the liver and hyperbilirubinemia. Adult homozygotes exhibit profound deafness, but not imbalance, associated with progressive degeneration of stereocilia of cochlear hair cells after the onset of hearing. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 T C 10: 80,002,518 V542A possibly damaging Het
Abhd8 G T 8: 71,461,745 R80S probably benign Het
Actc1 T C 2: 114,050,465 Y93C possibly damaging Het
Actn4 G T 7: 28,894,504 D859E possibly damaging Het
Adcy2 C T 13: 68,625,808 G1039R probably damaging Het
Als2 A G 1: 59,180,550 M1202T probably benign Het
Aste1 T A 9: 105,396,709 Y49* probably null Het
Atp8b4 T C 2: 126,392,830 D422G probably benign Het
Bag6 T A 17: 35,144,712 S791T probably damaging Het
Bivm T A 1: 44,128,789 W222R probably null Het
Bod1l A C 5: 41,788,923 V3003G probably benign Het
Bsn T C 9: 108,116,150 D801G probably benign Het
Ccdc14 G A 16: 34,706,789 D403N probably damaging Het
Cenpj T A 14: 56,542,862 E964V probably damaging Het
Cep250 C T 2: 155,970,122 A446V unknown Het
Clca3a1 G A 3: 144,758,034 R161W probably damaging Het
Dcxr A T 11: 120,726,546 V57E Het
Dnah17 T G 11: 118,046,178 N3400T possibly damaging Het
Dnaja3 C T 16: 4,702,300 T444I possibly damaging Het
Dopey1 T C 9: 86,513,155 S772P probably benign Het
Ednrb T C 14: 103,843,092 N129D probably damaging Het
Ep300 T A 15: 81,649,745 M2001K unknown Het
Fam3b A G 16: 97,501,000 I8T probably benign Het
Fam98c A T 7: 29,154,690 S85T Het
Fat1 G A 8: 45,009,841 V1232I probably benign Het
Fzd3 T A 14: 65,212,177 Y484F probably damaging Het
Gm13023 T A 4: 143,793,608 S141T probably benign Het
H3f3a T C 1: 180,803,095 I131M possibly damaging Het
Ifi206 A T 1: 173,471,456 D861E unknown Het
Ihh T C 1: 74,946,339 Y329C probably damaging Het
Jak2 A G 19: 29,301,062 N909D probably damaging Het
Krtap12-1 C A 10: 77,720,789 C55* probably null Het
Mical2 A C 7: 112,271,382 K26T possibly damaging Het
Mpp5 A G 12: 78,797,058 E12G probably benign Het
Mreg T C 1: 72,192,057 T81A probably benign Het
Muc16 T C 9: 18,647,582 T2472A unknown Het
Nanos3 A T 8: 84,176,451 D27E probably benign Het
Nox3 T G 17: 3,669,861 S350R probably damaging Het
Olfr1049 T A 2: 86,255,678 N5I probably damaging Het
Olfr734 A G 14: 50,320,757 V26A probably benign Het
Pafah2 C T 4: 134,419,970 T310M probably damaging Het
Pianp A G 6: 125,000,695 I185V probably benign Het
Pja2 T C 17: 64,309,475 T142A probably benign Het
Poln G A 5: 34,014,314 P747L probably damaging Het
Rnf146 A G 10: 29,347,543 W116R probably damaging Het
Rsf1 G GACGGCGGCT 7: 97,579,909 probably benign Het
Sec24d A G 3: 123,294,161 T224A probably benign Het
Serpinb9 T A 13: 33,006,703 I54K possibly damaging Het
Slc25a13 A T 6: 6,109,987 L324Q probably null Het
Slc9c1 T C 16: 45,580,127 L700P probably benign Het
Snta1 T C 2: 154,380,936 K289R probably benign Het
Sppl2a A G 2: 126,923,473 F243S probably damaging Het
Syne1 T C 10: 5,108,556 E7319G probably benign Het
Taf5l G A 8: 124,003,275 P225L probably benign Het
Tet2 A T 3: 133,469,613 N1324K possibly damaging Het
Usp5 A T 6: 124,823,451 probably null Het
Vmn2r124 G T 17: 18,074,177 R842L probably benign Het
Vps16 A G 2: 130,424,399 D2G possibly damaging Het
Vwf T C 6: 125,642,730 L1457P Het
Xpo1 A G 11: 23,285,058 T576A probably damaging Het
Zdhhc6 A T 19: 55,313,248 Y100* probably null Het
Zfp534 T A 4: 147,675,625 R196* probably null Het
Zfp710 C T 7: 80,081,374 R100W probably damaging Het
Zfp750 T C 11: 121,513,848 K67R probably benign Het
Zmynd10 T C 9: 107,549,127 S158P Het
Zmynd8 A T 2: 165,858,138 M1K probably null Het
Other mutations in Rdx
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00161:Rdx APN 9 52086346 missense probably damaging 1.00
IGL02088:Rdx APN 9 52060883 utr 5 prime probably benign
IGL02522:Rdx APN 9 52068204 missense possibly damaging 0.92
R0731:Rdx UTSW 9 52068218 missense probably benign 0.05
R0748:Rdx UTSW 9 52064860 missense possibly damaging 0.87
R0831:Rdx UTSW 9 52065817 missense probably damaging 1.00
R1605:Rdx UTSW 9 52063591 missense probably damaging 1.00
R1688:Rdx UTSW 9 52060911 splice site probably benign
R2127:Rdx UTSW 9 52069732 missense possibly damaging 0.49
R2363:Rdx UTSW 9 52068873 missense probably damaging 1.00
R2899:Rdx UTSW 9 52068911 splice site probably benign
R4184:Rdx UTSW 9 52067380 missense probably damaging 1.00
R4569:Rdx UTSW 9 52068841 missense probably benign 0.07
R4607:Rdx UTSW 9 52068837 missense probably damaging 0.99
R4760:Rdx UTSW 9 52065874 missense probably benign 0.02
R4820:Rdx UTSW 9 52063591 missense probably damaging 1.00
R4966:Rdx UTSW 9 52075009 missense probably benign 0.00
R6707:Rdx UTSW 9 52063654 missense probably damaging 1.00
R7136:Rdx UTSW 9 52086445 missense probably damaging 1.00
R7308:Rdx UTSW 9 52068870 missense probably damaging 0.98
R7597:Rdx UTSW 9 52060896 missense possibly damaging 0.84
R7835:Rdx UTSW 9 52065788 missense probably damaging 0.98
R7923:Rdx UTSW 9 52065901 missense possibly damaging 0.93
R8055:Rdx UTSW 9 52086424 missense probably damaging 1.00
R8057:Rdx UTSW 9 52065646 missense probably damaging 1.00
R8889:Rdx UTSW 9 52086453 missense probably damaging 1.00
R8983:Rdx UTSW 9 52063605 missense probably damaging 1.00
R9226:Rdx UTSW 9 52081168 missense probably benign 0.01
R9377:Rdx UTSW 9 52068868 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- TTGAGGCTATGATGTGAGCTAAC -3'
(R):5'- TTAACTGCACCATGAGCCCTG -3'

Sequencing Primer
(F):5'- AGTGATGTAACAGAATTGAGACAAG -3'
(R):5'- ATGAGCCCTGCAGTTAGTCAG -3'
Posted On 2022-01-20