Incidental Mutation 'R9128:Slc9c1'
ID 693432
Institutional Source Beutler Lab
Gene Symbol Slc9c1
Ensembl Gene ENSMUSG00000033210
Gene Name solute carrier family 9, subfamily C (Na+-transporting carboxylic acid decarboxylase), member 1
Synonyms LOC208169, Slc9a10, spermNHE
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.462) question?
Stock # R9128 (G1)
Quality Score 225.009
Status Not validated
Chromosome 16
Chromosomal Location 45535309-45607001 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 45580127 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 700 (L700P)
Ref Sequence ENSEMBL: ENSMUSP00000124969 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159945]
AlphaFold Q6UJY2
Predicted Effect probably benign
Transcript: ENSMUST00000159945
AA Change: L700P

PolyPhen 2 Score 0.254 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000124969
Gene: ENSMUSG00000033210
AA Change: L700P

DomainStartEndE-ValueType
Pfam:Na_H_Exchanger 40 445 2.3e-31 PFAM
low complexity region 588 602 N/A INTRINSIC
transmembrane domain 635 654 N/A INTRINSIC
transmembrane domain 669 686 N/A INTRINSIC
transmembrane domain 691 713 N/A INTRINSIC
low complexity region 734 743 N/A INTRINSIC
cNMP 890 1026 4.99e-1 SMART
low complexity region 1161 1175 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162151
Predicted Effect probably benign
Transcript: ENSMUST00000162774
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SLC9A10 is a member of the sodium-hydrogen exchanger (NHE) family (see SLC9A1, MIM 107310) and is required for male fertility and sperm motility (Wang et al., 2003 [PubMed 14634667]).[supplied by OMIM, Apr 2009]
PHENOTYPE: Homozygous null mice display male infertility and asthenozoospermia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 T C 10: 80,002,518 V542A possibly damaging Het
Abhd8 G T 8: 71,461,745 R80S probably benign Het
Actc1 T C 2: 114,050,465 Y93C possibly damaging Het
Actn4 G T 7: 28,894,504 D859E possibly damaging Het
Adcy2 C T 13: 68,625,808 G1039R probably damaging Het
Als2 A G 1: 59,180,550 M1202T probably benign Het
Aste1 T A 9: 105,396,709 Y49* probably null Het
Atp8b4 T C 2: 126,392,830 D422G probably benign Het
Bag6 T A 17: 35,144,712 S791T probably damaging Het
Bivm T A 1: 44,128,789 W222R probably null Het
Bod1l A C 5: 41,788,923 V3003G probably benign Het
Bsn T C 9: 108,116,150 D801G probably benign Het
Ccdc14 G A 16: 34,706,789 D403N probably damaging Het
Cenpj T A 14: 56,542,862 E964V probably damaging Het
Cep250 C T 2: 155,970,122 A446V unknown Het
Clca3a1 G A 3: 144,758,034 R161W probably damaging Het
Dcxr A T 11: 120,726,546 V57E Het
Dnah17 T G 11: 118,046,178 N3400T possibly damaging Het
Dnaja3 C T 16: 4,702,300 T444I possibly damaging Het
Dopey1 T C 9: 86,513,155 S772P probably benign Het
Ednrb T C 14: 103,843,092 N129D probably damaging Het
Ep300 T A 15: 81,649,745 M2001K unknown Het
Fam3b A G 16: 97,501,000 I8T probably benign Het
Fam98c A T 7: 29,154,690 S85T Het
Fat1 G A 8: 45,009,841 V1232I probably benign Het
Fzd3 T A 14: 65,212,177 Y484F probably damaging Het
Gm13023 T A 4: 143,793,608 S141T probably benign Het
H3f3a T C 1: 180,803,095 I131M possibly damaging Het
Ifi206 A T 1: 173,471,456 D861E unknown Het
Ihh T C 1: 74,946,339 Y329C probably damaging Het
Jak2 A G 19: 29,301,062 N909D probably damaging Het
Krtap12-1 C A 10: 77,720,789 C55* probably null Het
Mical2 A C 7: 112,271,382 K26T possibly damaging Het
Mpp5 A G 12: 78,797,058 E12G probably benign Het
Mreg T C 1: 72,192,057 T81A probably benign Het
Muc16 T C 9: 18,647,582 T2472A unknown Het
Nanos3 A T 8: 84,176,451 D27E probably benign Het
Nox3 T G 17: 3,669,861 S350R probably damaging Het
Olfr1049 T A 2: 86,255,678 N5I probably damaging Het
Olfr734 A G 14: 50,320,757 V26A probably benign Het
Pafah2 C T 4: 134,419,970 T310M probably damaging Het
Pianp A G 6: 125,000,695 I185V probably benign Het
Pja2 T C 17: 64,309,475 T142A probably benign Het
Poln G A 5: 34,014,314 P747L probably damaging Het
Rdx T A 9: 52,064,879 L39* probably null Het
Rnf146 A G 10: 29,347,543 W116R probably damaging Het
Rsf1 G GACGGCGGCT 7: 97,579,909 probably benign Het
Sec24d A G 3: 123,294,161 T224A probably benign Het
Serpinb9 T A 13: 33,006,703 I54K possibly damaging Het
Slc25a13 A T 6: 6,109,987 L324Q probably null Het
Snta1 T C 2: 154,380,936 K289R probably benign Het
Sppl2a A G 2: 126,923,473 F243S probably damaging Het
Syne1 T C 10: 5,108,556 E7319G probably benign Het
Taf5l G A 8: 124,003,275 P225L probably benign Het
Tet2 A T 3: 133,469,613 N1324K possibly damaging Het
Usp5 A T 6: 124,823,451 probably null Het
Vmn2r124 G T 17: 18,074,177 R842L probably benign Het
Vps16 A G 2: 130,424,399 D2G possibly damaging Het
Vwf T C 6: 125,642,730 L1457P Het
Xpo1 A G 11: 23,285,058 T576A probably damaging Het
Zdhhc6 A T 19: 55,313,248 Y100* probably null Het
Zfp534 T A 4: 147,675,625 R196* probably null Het
Zfp710 C T 7: 80,081,374 R100W probably damaging Het
Zfp750 T C 11: 121,513,848 K67R probably benign Het
Zmynd10 T C 9: 107,549,127 S158P Het
Zmynd8 A T 2: 165,858,138 M1K probably null Het
Other mutations in Slc9c1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Slc9c1 APN 16 45573389 missense possibly damaging 0.93
IGL00510:Slc9c1 APN 16 45539639 missense probably benign 0.00
IGL00949:Slc9c1 APN 16 45593358 missense probably benign
IGL01287:Slc9c1 APN 16 45584448 nonsense probably null
IGL01536:Slc9c1 APN 16 45589629 critical splice donor site probably null
IGL01655:Slc9c1 APN 16 45582972 missense probably benign
IGL01671:Slc9c1 APN 16 45560315 missense probably benign
IGL01720:Slc9c1 APN 16 45555769 missense probably damaging 1.00
IGL01758:Slc9c1 APN 16 45541461 missense probably damaging 1.00
IGL02031:Slc9c1 APN 16 45599470 missense probably benign 0.00
IGL02321:Slc9c1 APN 16 45556614 missense probably benign 0.02
IGL02472:Slc9c1 APN 16 45580142 missense probably benign 0.10
IGL02516:Slc9c1 APN 16 45577875 missense probably damaging 0.96
IGL02732:Slc9c1 APN 16 45550185 missense possibly damaging 0.78
IGL02741:Slc9c1 APN 16 45581598 missense possibly damaging 0.48
IGL02795:Slc9c1 APN 16 45575419 missense probably benign 0.06
IGL03032:Slc9c1 APN 16 45543261 splice site probably benign
IGL03062:Slc9c1 APN 16 45599758 missense probably benign 0.20
IGL03184:Slc9c1 APN 16 45547640 missense probably damaging 1.00
IGL03351:Slc9c1 APN 16 45543168 missense probably benign 0.01
P0041:Slc9c1 UTSW 16 45550161 missense possibly damaging 0.65
R0052:Slc9c1 UTSW 16 45606856 utr 3 prime probably benign
R0107:Slc9c1 UTSW 16 45575420 missense probably benign 0.00
R0255:Slc9c1 UTSW 16 45554300 missense probably benign 0.25
R0316:Slc9c1 UTSW 16 45580232 missense possibly damaging 0.72
R0437:Slc9c1 UTSW 16 45599887 splice site probably benign
R0611:Slc9c1 UTSW 16 45581602 missense possibly damaging 0.83
R0624:Slc9c1 UTSW 16 45573356 missense probably benign 0.00
R0630:Slc9c1 UTSW 16 45543120 splice site probably benign
R1106:Slc9c1 UTSW 16 45555807 missense possibly damaging 0.66
R1396:Slc9c1 UTSW 16 45573347 missense probably benign 0.43
R1727:Slc9c1 UTSW 16 45601961 missense probably benign 0.27
R1732:Slc9c1 UTSW 16 45552928 missense probably benign 0.21
R1754:Slc9c1 UTSW 16 45589509 missense probably benign 0.11
R1799:Slc9c1 UTSW 16 45554289 missense probably damaging 1.00
R1802:Slc9c1 UTSW 16 45558281 missense probably benign
R1813:Slc9c1 UTSW 16 45573347 missense probably benign 0.43
R1972:Slc9c1 UTSW 16 45593472 missense possibly damaging 0.89
R1985:Slc9c1 UTSW 16 45550106 missense probably benign 0.01
R1995:Slc9c1 UTSW 16 45554255 missense probably damaging 0.99
R2045:Slc9c1 UTSW 16 45580250 missense probably damaging 1.00
R2146:Slc9c1 UTSW 16 45593464 missense probably benign 0.19
R2511:Slc9c1 UTSW 16 45544736 missense possibly damaging 0.79
R3716:Slc9c1 UTSW 16 45580219 missense probably benign
R3765:Slc9c1 UTSW 16 45590881 missense possibly damaging 0.89
R3936:Slc9c1 UTSW 16 45606830 utr 3 prime probably benign
R4051:Slc9c1 UTSW 16 45543230 missense probably damaging 1.00
R4302:Slc9c1 UTSW 16 45544791 missense probably benign 0.35
R4433:Slc9c1 UTSW 16 45599466 missense possibly damaging 0.93
R4651:Slc9c1 UTSW 16 45547393 makesense probably null
R4928:Slc9c1 UTSW 16 45575409 missense probably benign 0.42
R4957:Slc9c1 UTSW 16 45544831 missense probably benign 0.45
R4989:Slc9c1 UTSW 16 45593437 missense probably benign 0.03
R5478:Slc9c1 UTSW 16 45554246 missense probably damaging 1.00
R5534:Slc9c1 UTSW 16 45556614 missense probably benign 0.00
R5898:Slc9c1 UTSW 16 45544760 missense probably damaging 1.00
R5939:Slc9c1 UTSW 16 45547668 missense probably benign 0.00
R6110:Slc9c1 UTSW 16 45575368 missense probably damaging 1.00
R6115:Slc9c1 UTSW 16 45555769 missense probably damaging 1.00
R6277:Slc9c1 UTSW 16 45606841 utr 3 prime probably benign
R6286:Slc9c1 UTSW 16 45577831 missense probably benign 0.14
R7268:Slc9c1 UTSW 16 45550116 missense probably damaging 1.00
R7272:Slc9c1 UTSW 16 45581515 missense possibly damaging 0.89
R7431:Slc9c1 UTSW 16 45593484 missense probably damaging 1.00
R7573:Slc9c1 UTSW 16 45577893 missense probably benign 0.00
R7881:Slc9c1 UTSW 16 45582969 missense probably benign 0.00
R8207:Slc9c1 UTSW 16 45539713 missense possibly damaging 0.65
R8289:Slc9c1 UTSW 16 45582981 missense probably benign 0.09
R8302:Slc9c1 UTSW 16 45547695 missense probably benign
R8328:Slc9c1 UTSW 16 45577864 missense probably damaging 0.97
R8421:Slc9c1 UTSW 16 45593371 missense probably damaging 0.97
R8691:Slc9c1 UTSW 16 45606819 missense probably benign 0.00
R8712:Slc9c1 UTSW 16 45560283 missense probably benign 0.00
R9191:Slc9c1 UTSW 16 45599781 missense possibly damaging 0.57
R9230:Slc9c1 UTSW 16 45577912 missense possibly damaging 0.93
R9248:Slc9c1 UTSW 16 45550188 missense probably benign 0.01
R9417:Slc9c1 UTSW 16 45593485 missense probably benign 0.45
R9519:Slc9c1 UTSW 16 45575407 missense probably damaging 1.00
R9570:Slc9c1 UTSW 16 45560342 missense probably benign 0.13
R9686:Slc9c1 UTSW 16 45580214 missense possibly damaging 0.72
R9695:Slc9c1 UTSW 16 45547663 missense probably benign 0.00
R9742:Slc9c1 UTSW 16 45580253 missense probably damaging 1.00
V8831:Slc9c1 UTSW 16 45577899 missense possibly damaging 0.89
Z1176:Slc9c1 UTSW 16 45558238 missense possibly damaging 0.48
Z1177:Slc9c1 UTSW 16 45573419 frame shift probably null
Predicted Primers PCR Primer
(F):5'- GATAACTGGTAATGTTTGCATTCCC -3'
(R):5'- AGCGGAAGTCATGTGTCCTG -3'

Sequencing Primer
(F):5'- GCCACTGAGAGTTTGAGTACACTTAG -3'
(R):5'- GAAGTCATGTGTCCTGCCCTTG -3'
Posted On 2022-01-20