Incidental Mutation 'R9128:Slc9c1'
ID 693432
Institutional Source Beutler Lab
Gene Symbol Slc9c1
Ensembl Gene ENSMUSG00000033210
Gene Name solute carrier family 9, subfamily C (Na+-transporting carboxylic acid decarboxylase), member 1
Synonyms LOC208169, spermNHE, Slc9a10
MMRRC Submission 068927-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.398) question?
Stock # R9128 (G1)
Quality Score 225.009
Status Not validated
Chromosome 16
Chromosomal Location 45355672-45427364 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 45400490 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 700 (L700P)
Ref Sequence ENSEMBL: ENSMUSP00000124969 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159945]
AlphaFold Q6UJY2
Predicted Effect probably benign
Transcript: ENSMUST00000159945
AA Change: L700P

PolyPhen 2 Score 0.254 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000124969
Gene: ENSMUSG00000033210
AA Change: L700P

DomainStartEndE-ValueType
Pfam:Na_H_Exchanger 40 445 2.3e-31 PFAM
low complexity region 588 602 N/A INTRINSIC
transmembrane domain 635 654 N/A INTRINSIC
transmembrane domain 669 686 N/A INTRINSIC
transmembrane domain 691 713 N/A INTRINSIC
low complexity region 734 743 N/A INTRINSIC
cNMP 890 1026 4.99e-1 SMART
low complexity region 1161 1175 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162151
Predicted Effect probably benign
Transcript: ENSMUST00000162774
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SLC9A10 is a member of the sodium-hydrogen exchanger (NHE) family (see SLC9A1, MIM 107310) and is required for male fertility and sperm motility (Wang et al., 2003 [PubMed 14634667]).[supplied by OMIM, Apr 2009]
PHENOTYPE: Homozygous null mice display male infertility and asthenozoospermia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 T C 10: 79,838,352 (GRCm39) V542A possibly damaging Het
Abhd8 G T 8: 71,914,389 (GRCm39) R80S probably benign Het
Actc1 T C 2: 113,880,946 (GRCm39) Y93C possibly damaging Het
Actn4 G T 7: 28,593,929 (GRCm39) D859E possibly damaging Het
Adcy2 C T 13: 68,773,927 (GRCm39) G1039R probably damaging Het
Als2 A G 1: 59,219,709 (GRCm39) M1202T probably benign Het
Aste1 T A 9: 105,273,908 (GRCm39) Y49* probably null Het
Atp8b4 T C 2: 126,234,750 (GRCm39) D422G probably benign Het
Bag6 T A 17: 35,363,688 (GRCm39) S791T probably damaging Het
Bivm T A 1: 44,167,949 (GRCm39) W222R probably null Het
Bod1l A C 5: 41,946,266 (GRCm39) V3003G probably benign Het
Bsn T C 9: 107,993,349 (GRCm39) D801G probably benign Het
Ccdc14 G A 16: 34,527,159 (GRCm39) D403N probably damaging Het
Cenpj T A 14: 56,780,319 (GRCm39) E964V probably damaging Het
Cep250 C T 2: 155,812,042 (GRCm39) A446V unknown Het
Clca3a1 G A 3: 144,463,795 (GRCm39) R161W probably damaging Het
Dcxr A T 11: 120,617,372 (GRCm39) V57E Het
Dnah17 T G 11: 117,937,004 (GRCm39) N3400T possibly damaging Het
Dnaja3 C T 16: 4,520,164 (GRCm39) T444I possibly damaging Het
Dop1a T C 9: 86,395,208 (GRCm39) S772P probably benign Het
Ednrb T C 14: 104,080,528 (GRCm39) N129D probably damaging Het
Ep300 T A 15: 81,533,946 (GRCm39) M2001K unknown Het
Fam3b A G 16: 97,302,200 (GRCm39) I8T probably benign Het
Fam98c A T 7: 28,854,115 (GRCm39) S85T Het
Fat1 G A 8: 45,462,878 (GRCm39) V1232I probably benign Het
Fzd3 T A 14: 65,449,626 (GRCm39) Y484F probably damaging Het
H3f3a T C 1: 180,630,660 (GRCm39) I131M possibly damaging Het
Ifi206 A T 1: 173,299,022 (GRCm39) D861E unknown Het
Ihh T C 1: 74,985,498 (GRCm39) Y329C probably damaging Het
Jak2 A G 19: 29,278,462 (GRCm39) N909D probably damaging Het
Krtap12-1 C A 10: 77,556,623 (GRCm39) C55* probably null Het
Mical2 A C 7: 111,870,589 (GRCm39) K26T possibly damaging Het
Mreg T C 1: 72,231,216 (GRCm39) T81A probably benign Het
Muc16 T C 9: 18,558,878 (GRCm39) T2472A unknown Het
Nanos3 A T 8: 84,903,080 (GRCm39) D27E probably benign Het
Nox3 T G 17: 3,720,136 (GRCm39) S350R probably damaging Het
Or4m1 A G 14: 50,558,214 (GRCm39) V26A probably benign Het
Or8k18 T A 2: 86,086,022 (GRCm39) N5I probably damaging Het
Pafah2 C T 4: 134,147,281 (GRCm39) T310M probably damaging Het
Pals1 A G 12: 78,843,832 (GRCm39) E12G probably benign Het
Pianp A G 6: 124,977,658 (GRCm39) I185V probably benign Het
Pja2 T C 17: 64,616,470 (GRCm39) T142A probably benign Het
Poln G A 5: 34,171,658 (GRCm39) P747L probably damaging Het
Pramel25 T A 4: 143,520,178 (GRCm39) S141T probably benign Het
Rdx T A 9: 51,976,179 (GRCm39) L39* probably null Het
Rnf146 A G 10: 29,223,539 (GRCm39) W116R probably damaging Het
Rsf1 G GACGGCGGCT 7: 97,229,116 (GRCm39) probably benign Het
Sec24d A G 3: 123,087,810 (GRCm39) T224A probably benign Het
Serpinb9 T A 13: 33,190,686 (GRCm39) I54K possibly damaging Het
Slc25a13 A T 6: 6,109,987 (GRCm39) L324Q probably null Het
Snta1 T C 2: 154,222,856 (GRCm39) K289R probably benign Het
Sppl2a A G 2: 126,765,393 (GRCm39) F243S probably damaging Het
Syne1 T C 10: 5,058,556 (GRCm39) E7319G probably benign Het
Taf5l G A 8: 124,730,014 (GRCm39) P225L probably benign Het
Tet2 A T 3: 133,175,374 (GRCm39) N1324K possibly damaging Het
Usp5 A T 6: 124,800,414 (GRCm39) probably null Het
Vmn2r124 G T 17: 18,294,439 (GRCm39) R842L probably benign Het
Vps16 A G 2: 130,266,319 (GRCm39) D2G possibly damaging Het
Vwf T C 6: 125,619,693 (GRCm39) L1457P Het
Xpo1 A G 11: 23,235,058 (GRCm39) T576A probably damaging Het
Zdhhc6 A T 19: 55,301,680 (GRCm39) Y100* probably null Het
Zfp534 T A 4: 147,760,082 (GRCm39) R196* probably null Het
Zfp710 C T 7: 79,731,122 (GRCm39) R100W probably damaging Het
Zfp750 T C 11: 121,404,674 (GRCm39) K67R probably benign Het
Zmynd10 T C 9: 107,426,326 (GRCm39) S158P Het
Zmynd8 A T 2: 165,700,058 (GRCm39) M1K probably null Het
Other mutations in Slc9c1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Slc9c1 APN 16 45,393,752 (GRCm39) missense possibly damaging 0.93
IGL00510:Slc9c1 APN 16 45,360,002 (GRCm39) missense probably benign 0.00
IGL00949:Slc9c1 APN 16 45,413,721 (GRCm39) missense probably benign
IGL01287:Slc9c1 APN 16 45,404,811 (GRCm39) nonsense probably null
IGL01536:Slc9c1 APN 16 45,409,992 (GRCm39) critical splice donor site probably null
IGL01655:Slc9c1 APN 16 45,403,335 (GRCm39) missense probably benign
IGL01671:Slc9c1 APN 16 45,380,678 (GRCm39) missense probably benign
IGL01720:Slc9c1 APN 16 45,376,132 (GRCm39) missense probably damaging 1.00
IGL01758:Slc9c1 APN 16 45,361,824 (GRCm39) missense probably damaging 1.00
IGL02031:Slc9c1 APN 16 45,419,833 (GRCm39) missense probably benign 0.00
IGL02321:Slc9c1 APN 16 45,376,977 (GRCm39) missense probably benign 0.02
IGL02472:Slc9c1 APN 16 45,400,505 (GRCm39) missense probably benign 0.10
IGL02516:Slc9c1 APN 16 45,398,238 (GRCm39) missense probably damaging 0.96
IGL02732:Slc9c1 APN 16 45,370,548 (GRCm39) missense possibly damaging 0.78
IGL02741:Slc9c1 APN 16 45,401,961 (GRCm39) missense possibly damaging 0.48
IGL02795:Slc9c1 APN 16 45,395,782 (GRCm39) missense probably benign 0.06
IGL03032:Slc9c1 APN 16 45,363,624 (GRCm39) splice site probably benign
IGL03062:Slc9c1 APN 16 45,420,121 (GRCm39) missense probably benign 0.20
IGL03184:Slc9c1 APN 16 45,368,003 (GRCm39) missense probably damaging 1.00
IGL03351:Slc9c1 APN 16 45,363,531 (GRCm39) missense probably benign 0.01
P0041:Slc9c1 UTSW 16 45,370,524 (GRCm39) missense possibly damaging 0.65
R0052:Slc9c1 UTSW 16 45,427,219 (GRCm39) utr 3 prime probably benign
R0107:Slc9c1 UTSW 16 45,395,783 (GRCm39) missense probably benign 0.00
R0255:Slc9c1 UTSW 16 45,374,663 (GRCm39) missense probably benign 0.25
R0316:Slc9c1 UTSW 16 45,400,595 (GRCm39) missense possibly damaging 0.72
R0437:Slc9c1 UTSW 16 45,420,250 (GRCm39) splice site probably benign
R0611:Slc9c1 UTSW 16 45,401,965 (GRCm39) missense possibly damaging 0.83
R0624:Slc9c1 UTSW 16 45,393,719 (GRCm39) missense probably benign 0.00
R0630:Slc9c1 UTSW 16 45,363,483 (GRCm39) splice site probably benign
R1106:Slc9c1 UTSW 16 45,376,170 (GRCm39) missense possibly damaging 0.66
R1396:Slc9c1 UTSW 16 45,393,710 (GRCm39) missense probably benign 0.43
R1727:Slc9c1 UTSW 16 45,422,324 (GRCm39) missense probably benign 0.27
R1732:Slc9c1 UTSW 16 45,373,291 (GRCm39) missense probably benign 0.21
R1754:Slc9c1 UTSW 16 45,409,872 (GRCm39) missense probably benign 0.11
R1799:Slc9c1 UTSW 16 45,374,652 (GRCm39) missense probably damaging 1.00
R1802:Slc9c1 UTSW 16 45,378,644 (GRCm39) missense probably benign
R1813:Slc9c1 UTSW 16 45,393,710 (GRCm39) missense probably benign 0.43
R1972:Slc9c1 UTSW 16 45,413,835 (GRCm39) missense possibly damaging 0.89
R1985:Slc9c1 UTSW 16 45,370,469 (GRCm39) missense probably benign 0.01
R1995:Slc9c1 UTSW 16 45,374,618 (GRCm39) missense probably damaging 0.99
R2045:Slc9c1 UTSW 16 45,400,613 (GRCm39) missense probably damaging 1.00
R2146:Slc9c1 UTSW 16 45,413,827 (GRCm39) missense probably benign 0.19
R2511:Slc9c1 UTSW 16 45,365,099 (GRCm39) missense possibly damaging 0.79
R3716:Slc9c1 UTSW 16 45,400,582 (GRCm39) missense probably benign
R3765:Slc9c1 UTSW 16 45,411,244 (GRCm39) missense possibly damaging 0.89
R3936:Slc9c1 UTSW 16 45,427,193 (GRCm39) utr 3 prime probably benign
R4051:Slc9c1 UTSW 16 45,363,593 (GRCm39) missense probably damaging 1.00
R4302:Slc9c1 UTSW 16 45,365,154 (GRCm39) missense probably benign 0.35
R4433:Slc9c1 UTSW 16 45,419,829 (GRCm39) missense possibly damaging 0.93
R4651:Slc9c1 UTSW 16 45,367,756 (GRCm39) makesense probably null
R4928:Slc9c1 UTSW 16 45,395,772 (GRCm39) missense probably benign 0.42
R4957:Slc9c1 UTSW 16 45,365,194 (GRCm39) missense probably benign 0.45
R4989:Slc9c1 UTSW 16 45,413,800 (GRCm39) missense probably benign 0.03
R5478:Slc9c1 UTSW 16 45,374,609 (GRCm39) missense probably damaging 1.00
R5534:Slc9c1 UTSW 16 45,376,977 (GRCm39) missense probably benign 0.00
R5898:Slc9c1 UTSW 16 45,365,123 (GRCm39) missense probably damaging 1.00
R5939:Slc9c1 UTSW 16 45,368,031 (GRCm39) missense probably benign 0.00
R6110:Slc9c1 UTSW 16 45,395,731 (GRCm39) missense probably damaging 1.00
R6115:Slc9c1 UTSW 16 45,376,132 (GRCm39) missense probably damaging 1.00
R6277:Slc9c1 UTSW 16 45,427,204 (GRCm39) utr 3 prime probably benign
R6286:Slc9c1 UTSW 16 45,398,194 (GRCm39) missense probably benign 0.14
R7268:Slc9c1 UTSW 16 45,370,479 (GRCm39) missense probably damaging 1.00
R7272:Slc9c1 UTSW 16 45,401,878 (GRCm39) missense possibly damaging 0.89
R7431:Slc9c1 UTSW 16 45,413,847 (GRCm39) missense probably damaging 1.00
R7573:Slc9c1 UTSW 16 45,398,256 (GRCm39) missense probably benign 0.00
R7881:Slc9c1 UTSW 16 45,403,332 (GRCm39) missense probably benign 0.00
R8207:Slc9c1 UTSW 16 45,360,076 (GRCm39) missense possibly damaging 0.65
R8289:Slc9c1 UTSW 16 45,403,344 (GRCm39) missense probably benign 0.09
R8302:Slc9c1 UTSW 16 45,368,058 (GRCm39) missense probably benign
R8328:Slc9c1 UTSW 16 45,398,227 (GRCm39) missense probably damaging 0.97
R8421:Slc9c1 UTSW 16 45,413,734 (GRCm39) missense probably damaging 0.97
R8691:Slc9c1 UTSW 16 45,427,182 (GRCm39) missense probably benign 0.00
R8712:Slc9c1 UTSW 16 45,380,646 (GRCm39) missense probably benign 0.00
R9191:Slc9c1 UTSW 16 45,420,144 (GRCm39) missense possibly damaging 0.57
R9230:Slc9c1 UTSW 16 45,398,275 (GRCm39) missense possibly damaging 0.93
R9248:Slc9c1 UTSW 16 45,370,551 (GRCm39) missense probably benign 0.01
R9417:Slc9c1 UTSW 16 45,413,848 (GRCm39) missense probably benign 0.45
R9519:Slc9c1 UTSW 16 45,395,770 (GRCm39) missense probably damaging 1.00
R9570:Slc9c1 UTSW 16 45,380,705 (GRCm39) missense probably benign 0.13
R9686:Slc9c1 UTSW 16 45,400,577 (GRCm39) missense possibly damaging 0.72
R9695:Slc9c1 UTSW 16 45,368,026 (GRCm39) missense probably benign 0.00
R9742:Slc9c1 UTSW 16 45,400,616 (GRCm39) missense probably damaging 1.00
V8831:Slc9c1 UTSW 16 45,398,262 (GRCm39) missense possibly damaging 0.89
Z1176:Slc9c1 UTSW 16 45,378,601 (GRCm39) missense possibly damaging 0.48
Z1177:Slc9c1 UTSW 16 45,393,782 (GRCm39) frame shift probably null
Predicted Primers PCR Primer
(F):5'- GATAACTGGTAATGTTTGCATTCCC -3'
(R):5'- AGCGGAAGTCATGTGTCCTG -3'

Sequencing Primer
(F):5'- GCCACTGAGAGTTTGAGTACACTTAG -3'
(R):5'- GAAGTCATGTGTCCTGCCCTTG -3'
Posted On 2022-01-20