Incidental Mutation 'R9128:Nox3'
ID 693434
Institutional Source Beutler Lab
Gene Symbol Nox3
Ensembl Gene ENSMUSG00000023802
Gene Name NADPH oxidase 3
Synonyms nmf250, het
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.360) question?
Stock # R9128 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 3635240-3696261 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to G at 3669861 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Arginine at position 350 (S350R)
Ref Sequence ENSEMBL: ENSMUSP00000111466 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115800]
AlphaFold Q672J9
Predicted Effect probably damaging
Transcript: ENSMUST00000115800
AA Change: S350R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000111466
Gene: ENSMUSG00000023802
AA Change: S350R

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:Ferric_reduct 55 218 5.4e-23 PFAM
Pfam:FAD_binding_6 290 379 1.8e-8 PFAM
Pfam:FAD_binding_8 291 393 1.5e-27 PFAM
Pfam:NAD_binding_6 399 549 1e-34 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the NOX family of NADPH oxidases. These enzymes catalyze the transfer of electrons from NADPH to molecular oxygen to produce superoxide and other reactive oxygen species (ROS). The ROS generated by family members have been implicated in numerous biological functions including host defense, posttranlational processing of proteins, cellular signaling, regulation of gene expression, and cell differentiation. The protein encoded by this gene is expressed predominantly in the inner ear and is involved in the biogenesis of otoconia, which are crystalline structures of the inner ear involved in the perception of gravity and linear acceleration. In mouse mutations of this gene lead to the absence of otoconia and vestibular dysfunction. [provided by RefSeq, Jun 2013]
PHENOTYPE: Homozygous mutants bilaterally lack otoliths in otherwise normal ears and display impaired swimming ability, motor capabilities, and vestibular responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 T C 10: 80,002,518 V542A possibly damaging Het
Abhd8 G T 8: 71,461,745 R80S probably benign Het
Actc1 T C 2: 114,050,465 Y93C possibly damaging Het
Actn4 G T 7: 28,894,504 D859E possibly damaging Het
Adcy2 C T 13: 68,625,808 G1039R probably damaging Het
Als2 A G 1: 59,180,550 M1202T probably benign Het
Aste1 T A 9: 105,396,709 Y49* probably null Het
Atp8b4 T C 2: 126,392,830 D422G probably benign Het
Bag6 T A 17: 35,144,712 S791T probably damaging Het
Bivm T A 1: 44,128,789 W222R probably null Het
Bod1l A C 5: 41,788,923 V3003G probably benign Het
Bsn T C 9: 108,116,150 D801G probably benign Het
Ccdc14 G A 16: 34,706,789 D403N probably damaging Het
Cenpj T A 14: 56,542,862 E964V probably damaging Het
Cep250 C T 2: 155,970,122 A446V unknown Het
Clca3a1 G A 3: 144,758,034 R161W probably damaging Het
Dcxr A T 11: 120,726,546 V57E Het
Dnah17 T G 11: 118,046,178 N3400T possibly damaging Het
Dnaja3 C T 16: 4,702,300 T444I possibly damaging Het
Dopey1 T C 9: 86,513,155 S772P probably benign Het
Ednrb T C 14: 103,843,092 N129D probably damaging Het
Ep300 T A 15: 81,649,745 M2001K unknown Het
Fam3b A G 16: 97,501,000 I8T probably benign Het
Fam98c A T 7: 29,154,690 S85T Het
Fat1 G A 8: 45,009,841 V1232I probably benign Het
Fzd3 T A 14: 65,212,177 Y484F probably damaging Het
Gm13023 T A 4: 143,793,608 S141T probably benign Het
H3f3a T C 1: 180,803,095 I131M possibly damaging Het
Ifi206 A T 1: 173,471,456 D861E unknown Het
Ihh T C 1: 74,946,339 Y329C probably damaging Het
Jak2 A G 19: 29,301,062 N909D probably damaging Het
Krtap12-1 C A 10: 77,720,789 C55* probably null Het
Mical2 A C 7: 112,271,382 K26T possibly damaging Het
Mpp5 A G 12: 78,797,058 E12G probably benign Het
Mreg T C 1: 72,192,057 T81A probably benign Het
Muc16 T C 9: 18,647,582 T2472A unknown Het
Nanos3 A T 8: 84,176,451 D27E probably benign Het
Olfr1049 T A 2: 86,255,678 N5I probably damaging Het
Olfr734 A G 14: 50,320,757 V26A probably benign Het
Pafah2 C T 4: 134,419,970 T310M probably damaging Het
Pianp A G 6: 125,000,695 I185V probably benign Het
Pja2 T C 17: 64,309,475 T142A probably benign Het
Poln G A 5: 34,014,314 P747L probably damaging Het
Rdx T A 9: 52,064,879 L39* probably null Het
Rnf146 A G 10: 29,347,543 W116R probably damaging Het
Rsf1 G GACGGCGGCT 7: 97,579,909 probably benign Het
Sec24d A G 3: 123,294,161 T224A probably benign Het
Serpinb9 T A 13: 33,006,703 I54K possibly damaging Het
Slc25a13 A T 6: 6,109,987 L324Q probably null Het
Slc9c1 T C 16: 45,580,127 L700P probably benign Het
Snta1 T C 2: 154,380,936 K289R probably benign Het
Sppl2a A G 2: 126,923,473 F243S probably damaging Het
Syne1 T C 10: 5,108,556 E7319G probably benign Het
Taf5l G A 8: 124,003,275 P225L probably benign Het
Tet2 A T 3: 133,469,613 N1324K possibly damaging Het
Usp5 A T 6: 124,823,451 probably null Het
Vmn2r124 G T 17: 18,074,177 R842L probably benign Het
Vps16 A G 2: 130,424,399 D2G possibly damaging Het
Vwf T C 6: 125,642,730 L1457P Het
Xpo1 A G 11: 23,285,058 T576A probably damaging Het
Zdhhc6 A T 19: 55,313,248 Y100* probably null Het
Zfp534 T A 4: 147,675,625 R196* probably null Het
Zfp710 C T 7: 80,081,374 R100W probably damaging Het
Zfp750 T C 11: 121,513,848 K67R probably benign Het
Zmynd10 T C 9: 107,549,127 S158P Het
Zmynd8 A T 2: 165,858,138 M1K probably null Het
Other mutations in Nox3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01024:Nox3 APN 17 3683015 missense probably damaging 0.99
IGL01135:Nox3 APN 17 3696252 utr 5 prime probably benign
IGL01791:Nox3 APN 17 3682943 missense possibly damaging 0.68
IGL02423:Nox3 APN 17 3682916 missense probably damaging 1.00
IGL03091:Nox3 APN 17 3665844 missense probably benign 0.42
R0046:Nox3 UTSW 17 3682961 missense probably benign 0.08
R0046:Nox3 UTSW 17 3682961 missense probably benign 0.08
R0085:Nox3 UTSW 17 3635281 missense probably benign 0.14
R0426:Nox3 UTSW 17 3695563 missense probably damaging 1.00
R0690:Nox3 UTSW 17 3695564 missense probably damaging 1.00
R1281:Nox3 UTSW 17 3696185 missense probably damaging 1.00
R1350:Nox3 UTSW 17 3650121 missense probably damaging 1.00
R1843:Nox3 UTSW 17 3669878 missense probably damaging 1.00
R1902:Nox3 UTSW 17 3670017 missense probably damaging 1.00
R2023:Nox3 UTSW 17 3694021 splice site probably benign
R2762:Nox3 UTSW 17 3696158 missense probably benign 0.35
R2872:Nox3 UTSW 17 3682916 missense probably damaging 1.00
R2872:Nox3 UTSW 17 3682916 missense probably damaging 1.00
R4429:Nox3 UTSW 17 3682958 missense probably benign 0.05
R4630:Nox3 UTSW 17 3693982 missense possibly damaging 0.53
R4926:Nox3 UTSW 17 3669894 missense probably damaging 1.00
R4928:Nox3 UTSW 17 3635275 missense probably null 1.00
R5181:Nox3 UTSW 17 3635286 nonsense probably null
R6911:Nox3 UTSW 17 3685923 missense probably damaging 1.00
R6912:Nox3 UTSW 17 3685923 missense probably damaging 1.00
R7486:Nox3 UTSW 17 3669944 missense probably damaging 1.00
R7529:Nox3 UTSW 17 3671775 missense probably damaging 0.99
R8355:Nox3 UTSW 17 3685923 missense probably damaging 1.00
R8357:Nox3 UTSW 17 3685923 missense probably damaging 1.00
R8455:Nox3 UTSW 17 3685923 missense probably damaging 1.00
R8457:Nox3 UTSW 17 3685923 missense probably damaging 1.00
R9028:Nox3 UTSW 17 3665910 missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- CCCGTTTGAAGTAGCACAGC -3'
(R):5'- TGGACAGAAGAATGTGCTCTTG -3'

Sequencing Primer
(F):5'- CAGCTTGTATATAACAGTGACCTGGG -3'
(R):5'- GAGTGAGAATCCCCTTGGCTATC -3'
Posted On 2022-01-20