Incidental Mutation 'R9129:Szt2'
ID 693457
Institutional Source Beutler Lab
Gene Symbol Szt2
Ensembl Gene ENSMUSG00000033253
Gene Name SZT2 subunit of KICSTOR complex
Synonyms seaizure threshold 2
MMRRC Submission
Accession Numbers
Essential gene? Possibly essential (E-score: 0.610) question?
Stock # R9129 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 118219940-118266470 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 118221866 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 3339 (V3339A)
Ref Sequence ENSEMBL: ENSMUSP00000074862 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006562] [ENSMUST00000075406] [ENSMUST00000106393] [ENSMUST00000194248]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000006562
SMART Domains Protein: ENSMUSP00000006562
Gene: ENSMUSG00000006395

DomainStartEndE-ValueType
Pfam:AP_endonuc_2 24 221 4.2e-28 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000075406
AA Change: V3339A
SMART Domains Protein: ENSMUSP00000074862
Gene: ENSMUSG00000033253
AA Change: V3339A

DomainStartEndE-ValueType
low complexity region 48 64 N/A INTRINSIC
Blast:VWA 93 343 1e-109 BLAST
low complexity region 704 728 N/A INTRINSIC
low complexity region 762 775 N/A INTRINSIC
low complexity region 779 793 N/A INTRINSIC
low complexity region 875 887 N/A INTRINSIC
low complexity region 994 1011 N/A INTRINSIC
low complexity region 1351 1370 N/A INTRINSIC
low complexity region 1619 1630 N/A INTRINSIC
low complexity region 1662 1678 N/A INTRINSIC
low complexity region 1832 1854 N/A INTRINSIC
low complexity region 1862 1881 N/A INTRINSIC
low complexity region 1895 1914 N/A INTRINSIC
low complexity region 2176 2184 N/A INTRINSIC
low complexity region 2284 2292 N/A INTRINSIC
low complexity region 2309 2323 N/A INTRINSIC
low complexity region 2373 2384 N/A INTRINSIC
low complexity region 2500 2508 N/A INTRINSIC
low complexity region 2669 2680 N/A INTRINSIC
low complexity region 2739 2758 N/A INTRINSIC
low complexity region 3239 3252 N/A INTRINSIC
low complexity region 3257 3268 N/A INTRINSIC
low complexity region 3283 3309 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106393
SMART Domains Protein: ENSMUSP00000102001
Gene: ENSMUSG00000006395

DomainStartEndE-ValueType
SCOP:d1k77a_ 4 67 4e-10 SMART
PDB:1K77|A 5 69 5e-7 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000183402
Predicted Effect probably benign
Transcript: ENSMUST00000194248
SMART Domains Protein: ENSMUSP00000141952
Gene: ENSMUSG00000006395

DomainStartEndE-ValueType
SCOP:d1k77a_ 4 77 3e-10 SMART
PDB:1K77|A 5 76 6e-8 PDB
low complexity region 246 260 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: This gene encodes a protein associated with low seizure threshold in mice and may contribute to susceptibility to epilepsy. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for mutations in this gene display increased susceptibility to induced seizures. Mice homozygous for null mutations also display partial penetrance of prenatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 A G 6: 128,523,223 (GRCm39) S1238P probably damaging Het
Akap9 T C 5: 4,119,089 (GRCm39) L3532S probably benign Het
Ankfn1 A G 11: 89,312,042 (GRCm39) L701P Het
Aph1b A C 9: 66,686,595 (GRCm39) I225S probably benign Het
Asic4 A T 1: 75,446,469 (GRCm39) H337L possibly damaging Het
Atp8b3 T C 10: 80,368,412 (GRCm39) E187G probably damaging Het
Atp9a A G 2: 168,517,205 (GRCm39) M376T probably benign Het
Bod1l G T 5: 41,976,220 (GRCm39) T1698K probably damaging Het
Cacna2d4 T C 6: 119,313,415 (GRCm39) probably null Het
Catsper1 C A 19: 5,390,402 (GRCm39) probably benign Het
Cd248 T C 19: 5,120,140 (GRCm39) S663P probably benign Het
Crispld2 A T 8: 120,737,488 (GRCm39) M80L possibly damaging Het
Cwc22 G A 2: 77,726,659 (GRCm39) Q807* probably null Het
Cyp2a4 T C 7: 26,014,136 (GRCm39) Y438H probably benign Het
Cyp2b23 A T 7: 26,381,189 (GRCm39) probably benign Het
Dsp T A 13: 38,377,126 (GRCm39) V1637D probably benign Het
Elovl1 A T 4: 118,289,156 (GRCm39) Y227F possibly damaging Het
Ern1 T C 11: 106,300,946 (GRCm39) K483E probably benign Het
Fzd2 T C 11: 102,496,465 (GRCm39) F303S probably benign Het
Gm9944 A T 4: 144,179,763 (GRCm39) V42D unknown Het
Grik5 G A 7: 24,767,429 (GRCm39) probably benign Het
Hdac4 T C 1: 91,909,929 (GRCm39) D445G probably benign Het
Hinfp C T 9: 44,209,062 (GRCm39) R352H probably damaging Het
Hrnr A G 3: 93,231,277 (GRCm39) H505R unknown Het
Hsfy2 C T 1: 56,675,752 (GRCm39) D262N probably benign Het
Hspa4 G A 11: 53,174,463 (GRCm39) Q186* probably null Het
Ipo8 T C 6: 148,700,125 (GRCm39) H584R probably benign Het
Krtap8-1 T A 16: 89,284,636 (GRCm39) R54* probably null Het
Lama4 T A 10: 38,932,887 (GRCm39) Y588N probably benign Het
Lekr1 T A 3: 65,591,426 (GRCm39) Y54* probably null Het
Ltbp2 G A 12: 84,837,864 (GRCm39) P1192L probably benign Het
Lypd10 A G 7: 24,413,170 (GRCm39) D163G probably benign Het
Lzts3 A T 2: 130,476,865 (GRCm39) Y528N possibly damaging Het
Mdn1 T A 4: 32,676,812 (GRCm39) V628E probably benign Het
Mgat5b A C 11: 116,859,348 (GRCm39) probably benign Het
Mical2 A C 7: 111,870,589 (GRCm39) K26T possibly damaging Het
Mllt10 C T 2: 18,167,404 (GRCm39) S443L probably benign Het
Mtf1 G A 4: 124,698,913 (GRCm39) probably benign Het
Myom2 T C 8: 15,154,068 (GRCm39) F669L probably damaging Het
Nlrp9c A T 7: 26,077,428 (GRCm39) probably null Het
Nog G C 11: 89,192,602 (GRCm39) S82W probably damaging Het
Ntrk2 A G 13: 59,276,084 (GRCm39) T795A probably benign Het
Or4a78 A G 2: 89,497,930 (GRCm39) F100S probably damaging Het
Or56a3b G A 7: 104,771,223 (GRCm39) M186I probably benign Het
Or5m3 A T 2: 85,838,356 (GRCm39) M79L Het
Or5w17 A T 2: 87,584,048 (GRCm39) F96L probably benign Het
Pira12 C A 7: 3,898,500 (GRCm39) probably null Het
Prl6a1 A T 13: 27,502,064 (GRCm39) I144L Het
Rab11fip5 A G 6: 85,317,892 (GRCm39) V999A probably benign Het
Serpinb6b TTGTTTCTGT TTGT 13: 33,162,139 (GRCm39) probably benign Het
Shisa6 A G 11: 66,110,853 (GRCm39) M296T probably benign Het
Slc18a1 T A 8: 69,491,533 (GRCm39) T494S probably benign Het
Slc22a29 T G 19: 8,146,669 (GRCm39) I378L probably benign Het
Slc23a2 C T 2: 131,920,332 (GRCm39) probably null Het
Slc2a7 G T 4: 150,243,001 (GRCm39) R274L probably benign Het
Spta1 A G 1: 174,058,911 (GRCm39) T1949A possibly damaging Het
Tcp10a G A 17: 7,593,935 (GRCm39) D87N probably benign Het
Tgm5 T G 2: 120,877,270 (GRCm39) Q638P probably damaging Het
Tmem145 A G 7: 25,014,265 (GRCm39) T460A possibly damaging Het
Ttc3 A T 16: 94,185,208 (GRCm39) M50L probably benign Het
Ush1c A G 7: 45,854,629 (GRCm39) S708P probably benign Het
Vmn1r217 T A 13: 23,298,876 (GRCm39) T9S probably benign Het
Vmn1r26 T C 6: 57,985,373 (GRCm39) Y272C Het
Vmn1r75 G T 7: 11,614,513 (GRCm39) A82S probably benign Het
Vmn2r117 T A 17: 23,678,918 (GRCm39) R769* probably null Het
Vps13b C A 15: 35,448,793 (GRCm39) A589E probably damaging Het
Vps13d G A 4: 144,898,249 (GRCm39) R304W Het
Vps41 A G 13: 19,011,775 (GRCm39) E294G probably benign Het
Xpo7 T C 14: 70,909,113 (GRCm39) T802A probably benign Het
Ylpm1 T A 12: 85,104,052 (GRCm39) D2022E Het
Zfp433 T A 10: 81,555,724 (GRCm39) C75* probably null Het
Zyg11a A T 4: 108,039,009 (GRCm39) S737T probably benign Het
Other mutations in Szt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Szt2 APN 4 118,241,447 (GRCm39) splice site probably benign
IGL01082:Szt2 APN 4 118,254,821 (GRCm39) missense probably damaging 1.00
IGL01348:Szt2 APN 4 118,250,821 (GRCm39) splice site probably benign
IGL01869:Szt2 APN 4 118,256,268 (GRCm39) missense possibly damaging 0.87
IGL01918:Szt2 APN 4 118,241,450 (GRCm39) splice site probably benign
IGL01951:Szt2 APN 4 118,233,690 (GRCm39) unclassified probably benign
IGL01971:Szt2 APN 4 118,244,152 (GRCm39) missense probably benign 0.01
IGL02047:Szt2 APN 4 118,233,834 (GRCm39) unclassified probably benign
IGL02092:Szt2 APN 4 118,220,529 (GRCm39) unclassified probably benign
IGL02120:Szt2 APN 4 118,245,761 (GRCm39) missense probably benign 0.01
IGL02210:Szt2 APN 4 118,247,020 (GRCm39) missense possibly damaging 0.95
IGL02435:Szt2 APN 4 118,248,020 (GRCm39) missense probably damaging 1.00
IGL02622:Szt2 APN 4 118,250,087 (GRCm39) missense probably damaging 0.96
IGL02666:Szt2 APN 4 118,231,252 (GRCm39) missense probably damaging 0.99
IGL02712:Szt2 APN 4 118,242,030 (GRCm39) missense probably benign 0.19
IGL02983:Szt2 APN 4 118,222,976 (GRCm39) unclassified probably benign
IGL03026:Szt2 APN 4 118,249,046 (GRCm39) missense probably benign 0.40
IGL03178:Szt2 APN 4 118,239,886 (GRCm39) missense unknown
IGL03233:Szt2 APN 4 118,229,726 (GRCm39) missense unknown
IGL03377:Szt2 APN 4 118,259,594 (GRCm39) splice site probably benign
IGL03387:Szt2 APN 4 118,221,922 (GRCm39) unclassified probably benign
PIT4687001:Szt2 UTSW 4 118,255,398 (GRCm39) missense possibly damaging 0.84
R0026:Szt2 UTSW 4 118,241,969 (GRCm39) missense possibly damaging 0.92
R0352:Szt2 UTSW 4 118,239,790 (GRCm39) missense unknown
R0396:Szt2 UTSW 4 118,233,544 (GRCm39) unclassified probably benign
R0504:Szt2 UTSW 4 118,230,149 (GRCm39) splice site probably null
R1033:Szt2 UTSW 4 118,244,303 (GRCm39) missense probably damaging 0.98
R1222:Szt2 UTSW 4 118,262,656 (GRCm39) missense possibly damaging 0.77
R1418:Szt2 UTSW 4 118,244,976 (GRCm39) missense probably benign 0.03
R1462:Szt2 UTSW 4 118,231,164 (GRCm39) missense unknown
R1462:Szt2 UTSW 4 118,231,164 (GRCm39) missense unknown
R1763:Szt2 UTSW 4 118,229,565 (GRCm39) missense unknown
R1772:Szt2 UTSW 4 118,262,714 (GRCm39) missense probably damaging 1.00
R1840:Szt2 UTSW 4 118,222,854 (GRCm39) unclassified probably benign
R1942:Szt2 UTSW 4 118,249,817 (GRCm39) missense probably benign 0.17
R1965:Szt2 UTSW 4 118,241,162 (GRCm39) missense probably benign 0.36
R1998:Szt2 UTSW 4 118,232,924 (GRCm39) critical splice donor site probably null
R2009:Szt2 UTSW 4 118,235,261 (GRCm39) critical splice donor site probably null
R2012:Szt2 UTSW 4 118,220,862 (GRCm39) unclassified probably benign
R2044:Szt2 UTSW 4 118,233,645 (GRCm39) nonsense probably null
R2066:Szt2 UTSW 4 118,231,177 (GRCm39) missense unknown
R2345:Szt2 UTSW 4 118,238,594 (GRCm39) missense unknown
R2857:Szt2 UTSW 4 118,226,599 (GRCm39) missense probably damaging 1.00
R3156:Szt2 UTSW 4 118,260,016 (GRCm39) critical splice donor site probably null
R3236:Szt2 UTSW 4 118,240,231 (GRCm39) splice site probably null
R3237:Szt2 UTSW 4 118,240,231 (GRCm39) splice site probably null
R3405:Szt2 UTSW 4 118,251,217 (GRCm39) missense probably benign 0.02
R3795:Szt2 UTSW 4 118,248,927 (GRCm39) missense probably damaging 1.00
R3878:Szt2 UTSW 4 118,247,782 (GRCm39) missense probably damaging 1.00
R3906:Szt2 UTSW 4 118,235,466 (GRCm39) unclassified probably benign
R4012:Szt2 UTSW 4 118,241,097 (GRCm39) missense probably benign 0.02
R4039:Szt2 UTSW 4 118,222,149 (GRCm39) unclassified probably benign
R4081:Szt2 UTSW 4 118,230,764 (GRCm39) splice site probably benign
R4298:Szt2 UTSW 4 118,222,603 (GRCm39) unclassified probably benign
R4299:Szt2 UTSW 4 118,222,603 (GRCm39) unclassified probably benign
R4432:Szt2 UTSW 4 118,241,428 (GRCm39) missense probably damaging 0.99
R4597:Szt2 UTSW 4 118,229,878 (GRCm39) missense unknown
R4657:Szt2 UTSW 4 118,254,866 (GRCm39) missense probably benign 0.06
R4663:Szt2 UTSW 4 118,234,881 (GRCm39) unclassified probably benign
R4670:Szt2 UTSW 4 118,233,026 (GRCm39) unclassified probably benign
R4704:Szt2 UTSW 4 118,251,026 (GRCm39) missense probably damaging 0.99
R4748:Szt2 UTSW 4 118,246,388 (GRCm39) nonsense probably null
R4786:Szt2 UTSW 4 118,256,259 (GRCm39) missense probably benign 0.20
R4809:Szt2 UTSW 4 118,246,182 (GRCm39) missense probably damaging 1.00
R4830:Szt2 UTSW 4 118,226,445 (GRCm39) missense unknown
R4944:Szt2 UTSW 4 118,245,866 (GRCm39) missense probably benign 0.03
R5077:Szt2 UTSW 4 118,226,813 (GRCm39) critical splice donor site probably null
R5121:Szt2 UTSW 4 118,242,641 (GRCm39) missense possibly damaging 0.92
R5140:Szt2 UTSW 4 118,244,178 (GRCm39) missense possibly damaging 0.46
R5169:Szt2 UTSW 4 118,247,027 (GRCm39) missense probably benign 0.26
R5198:Szt2 UTSW 4 118,245,519 (GRCm39) missense probably benign 0.03
R5433:Szt2 UTSW 4 118,232,663 (GRCm39) unclassified probably benign
R5625:Szt2 UTSW 4 118,230,414 (GRCm39) missense unknown
R5628:Szt2 UTSW 4 118,230,414 (GRCm39) missense unknown
R5630:Szt2 UTSW 4 118,250,102 (GRCm39) missense possibly damaging 0.83
R5808:Szt2 UTSW 4 118,229,810 (GRCm39) missense unknown
R5902:Szt2 UTSW 4 118,248,700 (GRCm39) missense probably benign 0.05
R6049:Szt2 UTSW 4 118,260,185 (GRCm39) missense probably damaging 0.99
R6066:Szt2 UTSW 4 118,229,171 (GRCm39) missense unknown
R6272:Szt2 UTSW 4 118,231,487 (GRCm39) unclassified probably benign
R6456:Szt2 UTSW 4 118,233,894 (GRCm39) unclassified probably benign
R6538:Szt2 UTSW 4 118,247,674 (GRCm39) splice site probably null
R6604:Szt2 UTSW 4 118,242,671 (GRCm39) missense probably benign 0.01
R6664:Szt2 UTSW 4 118,248,942 (GRCm39) missense probably damaging 1.00
R6834:Szt2 UTSW 4 118,245,522 (GRCm39) missense probably benign 0.01
R7109:Szt2 UTSW 4 118,232,676 (GRCm39) missense unknown
R7163:Szt2 UTSW 4 118,262,727 (GRCm39) missense possibly damaging 0.90
R7190:Szt2 UTSW 4 118,246,203 (GRCm39) missense probably damaging 0.98
R7289:Szt2 UTSW 4 118,233,075 (GRCm39) missense unknown
R7291:Szt2 UTSW 4 118,248,446 (GRCm39) missense probably damaging 0.98
R7383:Szt2 UTSW 4 118,222,411 (GRCm39) nonsense probably null
R7448:Szt2 UTSW 4 118,220,668 (GRCm39) missense unknown
R7637:Szt2 UTSW 4 118,251,025 (GRCm39) missense probably damaging 0.99
R7833:Szt2 UTSW 4 118,223,416 (GRCm39) missense unknown
R7896:Szt2 UTSW 4 118,260,110 (GRCm39) missense possibly damaging 0.62
R7923:Szt2 UTSW 4 118,231,037 (GRCm39) missense unknown
R8090:Szt2 UTSW 4 118,244,199 (GRCm39) splice site probably null
R8103:Szt2 UTSW 4 118,245,061 (GRCm39) missense possibly damaging 0.88
R8288:Szt2 UTSW 4 118,246,973 (GRCm39) missense probably damaging 0.96
R8309:Szt2 UTSW 4 118,232,679 (GRCm39) frame shift probably null
R8341:Szt2 UTSW 4 118,250,033 (GRCm39) missense possibly damaging 0.63
R8480:Szt2 UTSW 4 118,244,015 (GRCm39) missense probably benign 0.01
R8497:Szt2 UTSW 4 118,245,518 (GRCm39) missense possibly damaging 0.94
R8549:Szt2 UTSW 4 118,229,878 (GRCm39) missense unknown
R8768:Szt2 UTSW 4 118,226,613 (GRCm39) missense unknown
R8992:Szt2 UTSW 4 118,239,985 (GRCm39) splice site probably benign
R9001:Szt2 UTSW 4 118,235,529 (GRCm39) missense unknown
R9094:Szt2 UTSW 4 118,242,651 (GRCm39) missense possibly damaging 0.74
R9110:Szt2 UTSW 4 118,242,630 (GRCm39) missense possibly damaging 0.89
R9184:Szt2 UTSW 4 118,241,726 (GRCm39) missense possibly damaging 0.92
R9186:Szt2 UTSW 4 118,242,288 (GRCm39) missense probably damaging 1.00
R9424:Szt2 UTSW 4 118,248,151 (GRCm39) missense probably damaging 1.00
R9598:Szt2 UTSW 4 118,266,358 (GRCm39) critical splice donor site probably null
X0023:Szt2 UTSW 4 118,229,601 (GRCm39) missense unknown
Z1176:Szt2 UTSW 4 118,251,173 (GRCm39) missense probably damaging 0.99
Z1177:Szt2 UTSW 4 118,248,411 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAAAGGTTTCAATGGCAGTC -3'
(R):5'- TCCATTGCGGACATTGACCC -3'

Sequencing Primer
(F):5'- TGGTCTAACTCCAGCAAGGC -3'
(R):5'- ATTGACCCCCAGCTGGTAAGAG -3'
Posted On 2022-01-20