Incidental Mutation 'R9129:Serpinb6b'
ID 693497
Institutional Source Beutler Lab
Gene Symbol Serpinb6b
Ensembl Gene ENSMUSG00000042842
Gene Name serine (or cysteine) peptidase inhibitor, clade B, member 6b
Synonyms NK13, ovalbumin, Spi12
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.081) question?
Stock # R9129 (G1)
Quality Score 217.468
Status Not validated
Chromosome 13
Chromosomal Location 32965209-32979067 bp(+) (GRCm38)
Type of Mutation small deletion (2 aa in frame mutation)
DNA Base Change (assembly) TTGTTTCTGT to TTGT at 32978156 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000152419 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017184] [ENSMUST00000110293] [ENSMUST00000164541]
AlphaFold O08804
Predicted Effect probably benign
Transcript: ENSMUST00000017184
SMART Domains Protein: ENSMUSP00000017184
Gene: ENSMUSG00000042842

DomainStartEndE-ValueType
SERPIN 13 208 1.22e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110293
SMART Domains Protein: ENSMUSP00000105922
Gene: ENSMUSG00000042842

DomainStartEndE-ValueType
SERPIN 13 377 1.99e-174 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000164541
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 A G 6: 128,546,260 S1238P probably damaging Het
Akap9 T C 5: 4,069,089 L3532S probably benign Het
Ankfn1 A G 11: 89,421,216 L701P Het
Aph1b A C 9: 66,779,313 I225S probably benign Het
Asic4 A T 1: 75,469,825 H337L possibly damaging Het
Atp8b3 T C 10: 80,532,578 E187G probably damaging Het
Atp9a A G 2: 168,675,285 M376T probably benign Het
BC049730 A G 7: 24,713,745 D163G probably benign Het
Bod1l G T 5: 41,818,877 T1698K probably damaging Het
Cacna2d4 T C 6: 119,336,454 probably null Het
Cd248 T C 19: 5,070,112 S663P probably benign Het
Crispld2 A T 8: 120,010,749 M80L possibly damaging Het
Cwc22 G A 2: 77,896,315 Q807* probably null Het
Cyp2a4 T C 7: 26,314,711 Y438H probably benign Het
Dsp T A 13: 38,193,150 V1637D probably benign Het
Elovl1 A T 4: 118,431,959 Y227F possibly damaging Het
Ern1 T C 11: 106,410,120 K483E probably benign Het
Fzd2 T C 11: 102,605,639 F303S probably benign Het
Gm14548 C A 7: 3,895,501 probably null Het
Gm9944 A T 4: 144,453,193 V42D unknown Het
Hdac4 T C 1: 91,982,207 D445G probably benign Het
Hinfp C T 9: 44,297,765 R352H probably damaging Het
Hrnr A G 3: 93,323,970 H505R unknown Het
Hsfy2 C T 1: 56,636,593 D262N probably benign Het
Hspa4 G A 11: 53,283,636 Q186* probably null Het
Ipo8 T C 6: 148,798,627 H584R probably benign Het
Krtap8-1 T A 16: 89,487,748 R54* probably null Het
Lama4 T A 10: 39,056,891 Y588N probably benign Het
Lekr1 T A 3: 65,684,005 Y54* probably null Het
Ltbp2 G A 12: 84,791,090 P1192L probably benign Het
Lzts3 A T 2: 130,634,945 Y528N possibly damaging Het
Mdn1 T A 4: 32,676,812 V628E probably benign Het
Mical2 A C 7: 112,271,382 K26T possibly damaging Het
Mllt10 C T 2: 18,162,593 S443L probably benign Het
Myom2 T C 8: 15,104,068 F669L probably damaging Het
Nlrp9c A T 7: 26,378,003 probably null Het
Nog G C 11: 89,301,776 S82W probably damaging Het
Ntrk2 A G 13: 59,128,270 T795A probably benign Het
Olfr1032 A T 2: 86,008,012 M79L Het
Olfr1141 A T 2: 87,753,704 F96L probably benign Het
Olfr1251 A G 2: 89,667,586 F100S probably damaging Het
Olfr681 G A 7: 105,122,016 M186I probably benign Het
Prl6a1 A T 13: 27,318,081 I144L Het
Rab11fip5 A G 6: 85,340,910 V999A probably benign Het
Shisa6 A G 11: 66,220,027 M296T probably benign Het
Slc18a1 T A 8: 69,038,881 T494S probably benign Het
Slc22a29 T G 19: 8,169,305 I378L probably benign Het
Slc23a2 C T 2: 132,078,412 probably null Het
Slc2a7 G T 4: 150,158,544 R274L probably benign Het
Spta1 A G 1: 174,231,345 T1949A possibly damaging Het
Szt2 A G 4: 118,364,669 V3339A unknown Het
Tcp10a G A 17: 7,326,536 D87N probably benign Het
Tgm5 T G 2: 121,046,789 Q638P probably damaging Het
Tmem145 A G 7: 25,314,840 T460A possibly damaging Het
Ttc3 A T 16: 94,384,349 M50L probably benign Het
Ush1c A G 7: 46,205,205 S708P probably benign Het
Vmn1r217 T A 13: 23,114,706 T9S probably benign Het
Vmn1r26 T C 6: 58,008,388 Y272C Het
Vmn1r75 G T 7: 11,880,586 A82S probably benign Het
Vmn2r117 T A 17: 23,459,944 R769* probably null Het
Vps13b C A 15: 35,448,647 A589E probably damaging Het
Vps13d G A 4: 145,171,679 R304W Het
Vps41 A G 13: 18,827,605 E294G probably benign Het
Xpo7 T C 14: 70,671,673 T802A probably benign Het
Ylpm1 T A 12: 85,057,278 D2022E Het
Zfp433 T A 10: 81,719,890 C75* probably null Het
Zyg11a A T 4: 108,181,812 S737T probably benign Het
Other mutations in Serpinb6b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00719:Serpinb6b APN 13 32971546 missense probably benign 0.01
IGL01077:Serpinb6b APN 13 32978066 missense possibly damaging 0.68
IGL01553:Serpinb6b APN 13 32974948 missense probably damaging 1.00
IGL02981:Serpinb6b APN 13 32971606 missense probably benign 0.34
R0308:Serpinb6b UTSW 13 32978237 missense probably benign 0.09
R1568:Serpinb6b UTSW 13 32974912 missense probably damaging 1.00
R1692:Serpinb6b UTSW 13 32974995 missense probably damaging 1.00
R1763:Serpinb6b UTSW 13 32978058 missense probably damaging 1.00
R1917:Serpinb6b UTSW 13 32978240 missense probably benign
R1918:Serpinb6b UTSW 13 32978240 missense probably benign
R1919:Serpinb6b UTSW 13 32978240 missense probably benign
R1920:Serpinb6b UTSW 13 32975008 missense possibly damaging 0.47
R3032:Serpinb6b UTSW 13 32968568 missense possibly damaging 0.78
R4239:Serpinb6b UTSW 13 32972263 missense probably damaging 0.96
R5089:Serpinb6b UTSW 13 32978150 missense probably benign
R5503:Serpinb6b UTSW 13 32977659 missense possibly damaging 0.95
R5540:Serpinb6b UTSW 13 32977558 nonsense probably null
R6061:Serpinb6b UTSW 13 32977994 missense probably damaging 0.99
R6253:Serpinb6b UTSW 13 32972272 missense probably damaging 1.00
R7156:Serpinb6b UTSW 13 32971615 missense probably benign 0.09
R7248:Serpinb6b UTSW 13 32977576 missense probably benign 0.23
R7315:Serpinb6b UTSW 13 32972257 missense probably benign 0.41
R7424:Serpinb6b UTSW 13 32968667 missense probably damaging 0.99
R7547:Serpinb6b UTSW 13 32974924 missense probably benign 0.05
R7732:Serpinb6b UTSW 13 32968607 missense probably damaging 1.00
R7770:Serpinb6b UTSW 13 32977529 missense probably benign 0.05
R7802:Serpinb6b UTSW 13 32971596
R8814:Serpinb6b UTSW 13 32978304 missense possibly damaging 0.94
R8966:Serpinb6b UTSW 13 32978052 missense probably damaging 1.00
R8988:Serpinb6b UTSW 13 32978142 missense probably benign 0.45
R9037:Serpinb6b UTSW 13 32978015 nonsense probably null
R9377:Serpinb6b UTSW 13 32968511 start codon destroyed probably null 1.00
R9415:Serpinb6b UTSW 13 32975019 missense
Predicted Primers PCR Primer
(F):5'- AGCACTGACCTAAGATCTTGAACTG -3'
(R):5'- ACACAATCCCACTGGTCCTG -3'

Sequencing Primer
(F):5'- CTTGAACTGTCTTCTAGGTGGAAAAG -3'
(R):5'- TCCTGCTGTGTTGGATGAAGAAAAG -3'
Posted On 2022-01-20