Incidental Mutation 'R9129:Vmn2r117'
ID 693505
Institutional Source Beutler Lab
Gene Symbol Vmn2r117
Ensembl Gene ENSMUSG00000091407
Gene Name vomeronasal 2, receptor 117
Synonyms EG619788, V2Rp6
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.083) question?
Stock # R9129 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 23678649-23698571 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) T to A at 23678918 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Stop codon at position 769 (R769*)
Ref Sequence ENSEMBL: ENSMUSP00000126885 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000171996]
AlphaFold K7N6V1
Predicted Effect probably null
Transcript: ENSMUST00000171996
AA Change: R769*
SMART Domains Protein: ENSMUSP00000126885
Gene: ENSMUSG00000091407
AA Change: R769*

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 73 471 2.6e-28 PFAM
Pfam:NCD3G 512 565 5e-20 PFAM
Pfam:7tm_3 595 833 8.2e-54 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 99% (68/69)
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 A G 6: 128,523,223 (GRCm39) S1238P probably damaging Het
Akap9 T C 5: 4,119,089 (GRCm39) L3532S probably benign Het
Ankfn1 A G 11: 89,312,042 (GRCm39) L701P Het
Aph1b A C 9: 66,686,595 (GRCm39) I225S probably benign Het
Asic4 A T 1: 75,446,469 (GRCm39) H337L possibly damaging Het
Atp8b3 T C 10: 80,368,412 (GRCm39) E187G probably damaging Het
Atp9a A G 2: 168,517,205 (GRCm39) M376T probably benign Het
Bod1l G T 5: 41,976,220 (GRCm39) T1698K probably damaging Het
Cacna2d4 T C 6: 119,313,415 (GRCm39) probably null Het
Catsper1 C A 19: 5,390,402 (GRCm39) probably benign Het
Cd248 T C 19: 5,120,140 (GRCm39) S663P probably benign Het
Crispld2 A T 8: 120,737,488 (GRCm39) M80L possibly damaging Het
Cwc22 G A 2: 77,726,659 (GRCm39) Q807* probably null Het
Cyp2a4 T C 7: 26,014,136 (GRCm39) Y438H probably benign Het
Cyp2b23 A T 7: 26,381,189 (GRCm39) probably benign Het
Dsp T A 13: 38,377,126 (GRCm39) V1637D probably benign Het
Elovl1 A T 4: 118,289,156 (GRCm39) Y227F possibly damaging Het
Ern1 T C 11: 106,300,946 (GRCm39) K483E probably benign Het
Fzd2 T C 11: 102,496,465 (GRCm39) F303S probably benign Het
Gm9944 A T 4: 144,179,763 (GRCm39) V42D unknown Het
Grik5 G A 7: 24,767,429 (GRCm39) probably benign Het
Hdac4 T C 1: 91,909,929 (GRCm39) D445G probably benign Het
Hinfp C T 9: 44,209,062 (GRCm39) R352H probably damaging Het
Hrnr A G 3: 93,231,277 (GRCm39) H505R unknown Het
Hsfy2 C T 1: 56,675,752 (GRCm39) D262N probably benign Het
Hspa4 G A 11: 53,174,463 (GRCm39) Q186* probably null Het
Ipo8 T C 6: 148,700,125 (GRCm39) H584R probably benign Het
Krtap8-1 T A 16: 89,284,636 (GRCm39) R54* probably null Het
Lama4 T A 10: 38,932,887 (GRCm39) Y588N probably benign Het
Lekr1 T A 3: 65,591,426 (GRCm39) Y54* probably null Het
Ltbp2 G A 12: 84,837,864 (GRCm39) P1192L probably benign Het
Lypd10 A G 7: 24,413,170 (GRCm39) D163G probably benign Het
Lzts3 A T 2: 130,476,865 (GRCm39) Y528N possibly damaging Het
Mdn1 T A 4: 32,676,812 (GRCm39) V628E probably benign Het
Mgat5b A C 11: 116,859,348 (GRCm39) probably benign Het
Mical2 A C 7: 111,870,589 (GRCm39) K26T possibly damaging Het
Mllt10 C T 2: 18,167,404 (GRCm39) S443L probably benign Het
Mtf1 G A 4: 124,698,913 (GRCm39) probably benign Het
Myom2 T C 8: 15,154,068 (GRCm39) F669L probably damaging Het
Nlrp9c A T 7: 26,077,428 (GRCm39) probably null Het
Nog G C 11: 89,192,602 (GRCm39) S82W probably damaging Het
Ntrk2 A G 13: 59,276,084 (GRCm39) T795A probably benign Het
Or4a78 A G 2: 89,497,930 (GRCm39) F100S probably damaging Het
Or56a3b G A 7: 104,771,223 (GRCm39) M186I probably benign Het
Or5m3 A T 2: 85,838,356 (GRCm39) M79L Het
Or5w17 A T 2: 87,584,048 (GRCm39) F96L probably benign Het
Pira12 C A 7: 3,898,500 (GRCm39) probably null Het
Prl6a1 A T 13: 27,502,064 (GRCm39) I144L Het
Rab11fip5 A G 6: 85,317,892 (GRCm39) V999A probably benign Het
Serpinb6b TTGTTTCTGT TTGT 13: 33,162,139 (GRCm39) probably benign Het
Shisa6 A G 11: 66,110,853 (GRCm39) M296T probably benign Het
Slc18a1 T A 8: 69,491,533 (GRCm39) T494S probably benign Het
Slc22a29 T G 19: 8,146,669 (GRCm39) I378L probably benign Het
Slc23a2 C T 2: 131,920,332 (GRCm39) probably null Het
Slc2a7 G T 4: 150,243,001 (GRCm39) R274L probably benign Het
Spta1 A G 1: 174,058,911 (GRCm39) T1949A possibly damaging Het
Szt2 A G 4: 118,221,866 (GRCm39) V3339A unknown Het
Tcp10a G A 17: 7,593,935 (GRCm39) D87N probably benign Het
Tgm5 T G 2: 120,877,270 (GRCm39) Q638P probably damaging Het
Tmem145 A G 7: 25,014,265 (GRCm39) T460A possibly damaging Het
Ttc3 A T 16: 94,185,208 (GRCm39) M50L probably benign Het
Ush1c A G 7: 45,854,629 (GRCm39) S708P probably benign Het
Vmn1r217 T A 13: 23,298,876 (GRCm39) T9S probably benign Het
Vmn1r26 T C 6: 57,985,373 (GRCm39) Y272C Het
Vmn1r75 G T 7: 11,614,513 (GRCm39) A82S probably benign Het
Vps13b C A 15: 35,448,793 (GRCm39) A589E probably damaging Het
Vps13d G A 4: 144,898,249 (GRCm39) R304W Het
Vps41 A G 13: 19,011,775 (GRCm39) E294G probably benign Het
Xpo7 T C 14: 70,909,113 (GRCm39) T802A probably benign Het
Ylpm1 T A 12: 85,104,052 (GRCm39) D2022E Het
Zfp433 T A 10: 81,555,724 (GRCm39) C75* probably null Het
Zyg11a A T 4: 108,039,009 (GRCm39) S737T probably benign Het
Other mutations in Vmn2r117
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Vmn2r117 APN 17 23,698,520 (GRCm39) missense probably benign
IGL00990:Vmn2r117 APN 17 23,696,814 (GRCm39) missense probably damaging 1.00
IGL00990:Vmn2r117 APN 17 23,694,403 (GRCm39) missense probably damaging 1.00
IGL01078:Vmn2r117 APN 17 23,696,778 (GRCm39) missense probably damaging 1.00
IGL01139:Vmn2r117 APN 17 23,696,778 (GRCm39) missense probably damaging 1.00
IGL01374:Vmn2r117 APN 17 23,697,356 (GRCm39) missense possibly damaging 0.46
IGL01779:Vmn2r117 APN 17 23,696,215 (GRCm39) missense probably benign 0.00
IGL02283:Vmn2r117 APN 17 23,694,356 (GRCm39) missense probably damaging 0.99
IGL02527:Vmn2r117 APN 17 23,696,199 (GRCm39) missense possibly damaging 0.65
IGL02612:Vmn2r117 APN 17 23,678,758 (GRCm39) missense possibly damaging 0.91
IGL02887:Vmn2r117 APN 17 23,694,552 (GRCm39) splice site probably benign
IGL03167:Vmn2r117 APN 17 23,696,681 (GRCm39) missense probably damaging 1.00
R0315:Vmn2r117 UTSW 17 23,679,139 (GRCm39) missense probably benign 0.11
R0610:Vmn2r117 UTSW 17 23,694,488 (GRCm39) missense probably benign 0.00
R0747:Vmn2r117 UTSW 17 23,694,477 (GRCm39) nonsense probably null
R1411:Vmn2r117 UTSW 17 23,679,527 (GRCm39) missense probably damaging 1.00
R1471:Vmn2r117 UTSW 17 23,697,447 (GRCm39) missense probably benign 0.00
R1853:Vmn2r117 UTSW 17 23,696,429 (GRCm39) missense probably damaging 0.99
R1925:Vmn2r117 UTSW 17 23,697,363 (GRCm39) missense probably benign 0.00
R1940:Vmn2r117 UTSW 17 23,696,454 (GRCm39) missense probably damaging 1.00
R2005:Vmn2r117 UTSW 17 23,696,618 (GRCm39) missense probably damaging 1.00
R2082:Vmn2r117 UTSW 17 23,679,230 (GRCm39) missense possibly damaging 0.55
R2698:Vmn2r117 UTSW 17 23,678,885 (GRCm39) missense probably damaging 0.98
R2972:Vmn2r117 UTSW 17 23,678,830 (GRCm39) missense probably damaging 1.00
R2973:Vmn2r117 UTSW 17 23,678,830 (GRCm39) missense probably damaging 1.00
R2974:Vmn2r117 UTSW 17 23,678,830 (GRCm39) missense probably damaging 1.00
R3160:Vmn2r117 UTSW 17 23,679,352 (GRCm39) missense probably damaging 1.00
R3161:Vmn2r117 UTSW 17 23,679,352 (GRCm39) missense probably damaging 1.00
R3162:Vmn2r117 UTSW 17 23,679,352 (GRCm39) missense probably damaging 1.00
R3847:Vmn2r117 UTSW 17 23,679,389 (GRCm39) missense probably damaging 0.97
R3848:Vmn2r117 UTSW 17 23,679,389 (GRCm39) missense probably damaging 0.97
R4082:Vmn2r117 UTSW 17 23,679,080 (GRCm39) missense probably benign 0.00
R4320:Vmn2r117 UTSW 17 23,698,487 (GRCm39) frame shift probably null
R4560:Vmn2r117 UTSW 17 23,678,851 (GRCm39) missense probably damaging 1.00
R4658:Vmn2r117 UTSW 17 23,697,390 (GRCm39) missense probably benign 0.01
R4881:Vmn2r117 UTSW 17 23,696,859 (GRCm39) missense probably damaging 1.00
R4908:Vmn2r117 UTSW 17 23,678,812 (GRCm39) missense probably damaging 1.00
R4910:Vmn2r117 UTSW 17 23,698,487 (GRCm39) frame shift probably null
R5078:Vmn2r117 UTSW 17 23,679,122 (GRCm39) missense probably damaging 1.00
R5327:Vmn2r117 UTSW 17 23,696,848 (GRCm39) nonsense probably null
R5774:Vmn2r117 UTSW 17 23,696,176 (GRCm39) missense probably damaging 0.98
R6014:Vmn2r117 UTSW 17 23,698,535 (GRCm39) missense probably damaging 0.97
R6390:Vmn2r117 UTSW 17 23,679,088 (GRCm39) missense possibly damaging 0.95
R6520:Vmn2r117 UTSW 17 23,679,193 (GRCm39) missense probably damaging 0.99
R6674:Vmn2r117 UTSW 17 23,679,023 (GRCm39) nonsense probably null
R6736:Vmn2r117 UTSW 17 23,697,282 (GRCm39) missense probably damaging 0.99
R6909:Vmn2r117 UTSW 17 23,698,479 (GRCm39) missense possibly damaging 0.67
R6913:Vmn2r117 UTSW 17 23,698,537 (GRCm39) missense probably damaging 0.99
R7220:Vmn2r117 UTSW 17 23,696,177 (GRCm39) missense probably damaging 1.00
R7260:Vmn2r117 UTSW 17 23,694,359 (GRCm39) missense probably benign 0.06
R7440:Vmn2r117 UTSW 17 23,694,539 (GRCm39) missense probably benign 0.26
R7443:Vmn2r117 UTSW 17 23,679,319 (GRCm39) missense probably damaging 1.00
R7443:Vmn2r117 UTSW 17 23,679,107 (GRCm39) missense probably benign 0.25
R7449:Vmn2r117 UTSW 17 23,678,869 (GRCm39) missense probably damaging 1.00
R7644:Vmn2r117 UTSW 17 23,696,265 (GRCm39) missense probably damaging 0.98
R7914:Vmn2r117 UTSW 17 23,679,100 (GRCm39) missense possibly damaging 0.95
R8001:Vmn2r117 UTSW 17 23,698,381 (GRCm39) missense possibly damaging 0.89
R8029:Vmn2r117 UTSW 17 23,696,744 (GRCm39) missense probably benign 0.00
R8340:Vmn2r117 UTSW 17 23,679,511 (GRCm39) missense probably benign 0.01
R8519:Vmn2r117 UTSW 17 23,698,442 (GRCm39) missense probably benign
R8723:Vmn2r117 UTSW 17 23,696,343 (GRCm39) missense probably damaging 1.00
R8914:Vmn2r117 UTSW 17 23,679,143 (GRCm39) missense probably benign 0.02
R9010:Vmn2r117 UTSW 17 23,679,445 (GRCm39) missense probably benign 0.10
R9244:Vmn2r117 UTSW 17 23,696,589 (GRCm39) missense probably damaging 0.98
R9464:Vmn2r117 UTSW 17 23,696,578 (GRCm39) missense probably benign 0.23
R9620:Vmn2r117 UTSW 17 23,697,450 (GRCm39) missense probably damaging 0.97
V5622:Vmn2r117 UTSW 17 23,698,479 (GRCm39) missense possibly damaging 0.67
V5622:Vmn2r117 UTSW 17 23,696,814 (GRCm39) missense probably damaging 1.00
Z1176:Vmn2r117 UTSW 17 23,678,740 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGGAAGATGATTTCACCCTGATC -3'
(R):5'- CAAGTTATTGTATGTGCAGTCTGGC -3'

Sequencing Primer
(F):5'- GATTTCACCCTGATCATTTCAAGAG -3'
(R):5'- AGTCTGGCTGAGAGCTTCTCC -3'
Posted On 2022-01-20