Mutagenetix > Incidental Mutation

Incidental Mutation 'R9130:Kmt2c'

693531

Institutional Source

Beutler Lab

Gene Symbol

Kmt2c

Ensembl Gene

ENSMUSG00000038056

Gene Name

lysine (K)-specific methyltransferase 2C

Synonyms

Mll3, E330008K23Rik, HALR

MMRRC Submission

068928-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R9130 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

25271798-25498783 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 25311104 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Glutamine at position 2580 (H2580Q)

Ref Sequence

ENSEMBL: ENSMUSP00000043874 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000045291] [ENSMUST00000173073]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000045291
AA Change: H2580Q

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)

SMART Domains

Protein: ENSMUSP00000043874
Gene: ENSMUSG00000038056
AA Change: H2580Q

Domain	Start	End	E-Value	Type
low complexity region	9	32	N/A	INTRINSIC
AT_hook	34	46	9.68e-1	SMART
low complexity region	73	87	N/A	INTRINSIC
PHD	283	330	2.56e-2	SMART
C1	329	384	5.45e-1	SMART
PHD	342	388	4.19e-7	SMART
RING	343	387	1.45e-1	SMART
PHD	389	435	4.77e-11	SMART
RING	390	434	1.46e0	SMART
PHD	465	517	8.25e-6	SMART
low complexity region	776	789	N/A	INTRINSIC
AT_hook	898	910	1.41e2	SMART
PHD	953	1002	2.89e-10	SMART
RING	954	1001	4.74e0	SMART
C1	994	1045	8.38e-2	SMART
PHD	1003	1049	1.05e-12	SMART
PHD	1080	1131	2.08e-2	SMART
low complexity region	1189	1201	N/A	INTRINSIC
low complexity region	1337	1348	N/A	INTRINSIC
low complexity region	1394	1406	N/A	INTRINSIC
low complexity region	1431	1442	N/A	INTRINSIC
low complexity region	1520	1539	N/A	INTRINSIC
low complexity region	1557	1570	N/A	INTRINSIC
HMG	1639	1703	2.64e-3	SMART
low complexity region	1708	1724	N/A	INTRINSIC
coiled coil region	1745	1789	N/A	INTRINSIC
low complexity region	1847	1860	N/A	INTRINSIC
low complexity region	1864	1891	N/A	INTRINSIC
internal_repeat_3	1893	2084	1.27e-14	PROSPERO
internal_repeat_3	2123	2306	1.27e-14	PROSPERO
low complexity region	2336	2348	N/A	INTRINSIC
low complexity region	2375	2394	N/A	INTRINSIC
low complexity region	2427	2440	N/A	INTRINSIC
low complexity region	2516	2527	N/A	INTRINSIC
low complexity region	2696	2720	N/A	INTRINSIC
low complexity region	2723	2742	N/A	INTRINSIC
low complexity region	2930	2943	N/A	INTRINSIC
coiled coil region	3048	3075	N/A	INTRINSIC
low complexity region	3156	3165	N/A	INTRINSIC
low complexity region	3173	3195	N/A	INTRINSIC
coiled coil region	3226	3270	N/A	INTRINSIC
low complexity region	3277	3290	N/A	INTRINSIC
coiled coil region	3389	3427	N/A	INTRINSIC
low complexity region	3460	3486	N/A	INTRINSIC
low complexity region	3597	3611	N/A	INTRINSIC
low complexity region	3649	3667	N/A	INTRINSIC
low complexity region	3769	3783	N/A	INTRINSIC
low complexity region	3822	3827	N/A	INTRINSIC
low complexity region	3860	3869	N/A	INTRINSIC
low complexity region	3887	3904	N/A	INTRINSIC
low complexity region	3994	4009	N/A	INTRINSIC
low complexity region	4015	4038	N/A	INTRINSIC
low complexity region	4293	4309	N/A	INTRINSIC
low complexity region	4412	4419	N/A	INTRINSIC
PHD	4454	4500	2.94e-2	SMART
RING	4455	4499	8.1e0	SMART
FYRN	4554	4597	1.18e-21	SMART
FYRC	4603	4690	4.54e-32	SMART
SET	4764	4886	3.17e-34	SMART
PostSET	4888	4904	1.82e-6	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000172556

SMART Domains

Protein: ENSMUSP00000133941
Gene: ENSMUSG00000038056

Domain	Start	End	E-Value	Type
SCOP:d2spca_	84	177	1e-3	SMART
low complexity region	196	209	N/A	INTRINSIC
coiled coil region	307	345	N/A	INTRINSIC
low complexity region	379	405	N/A	INTRINSIC
low complexity region	516	530	N/A	INTRINSIC
low complexity region	568	586	N/A	INTRINSIC
low complexity region	688	702	N/A	INTRINSIC
low complexity region	735	752	N/A	INTRINSIC
low complexity region	842	857	N/A	INTRINSIC
low complexity region	863	886	N/A	INTRINSIC
low complexity region	1141	1157	N/A	INTRINSIC
low complexity region	1260	1267	N/A	INTRINSIC
PHD	1302	1348	2.94e-2	SMART
FYRN	1402	1445	1.18e-21	SMART
FYRC	1451	1538	4.54e-32	SMART
SET	1608	1730	3.17e-34	SMART
PostSET	1732	1748	1.82e-6	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000173073

SMART Domains

Protein: ENSMUSP00000134442
Gene: ENSMUSG00000038056

Domain	Start	End	E-Value	Type
low complexity region	9	32	N/A	INTRINSIC
AT_hook	34	46	9.68e-1	SMART
low complexity region	73	87	N/A	INTRINSIC
PHD	283	330	2.56e-2	SMART
C1	329	384	5.45e-1	SMART
PHD	342	388	4.19e-7	SMART
RING	343	387	1.45e-1	SMART
PHD	389	435	4.77e-11	SMART
RING	390	434	1.46e0	SMART
PHD	465	517	8.25e-6	SMART
low complexity region	776	789	N/A	INTRINSIC
AT_hook	858	870	1.41e2	SMART
PHD	913	962	2.89e-10	SMART
RING	914	961	4.74e0	SMART
C1	954	1005	8.38e-2	SMART
PHD	963	1009	1.05e-12	SMART
PHD	1040	1091	2.08e-2	SMART
low complexity region	1149	1161	N/A	INTRINSIC
low complexity region	1297	1308	N/A	INTRINSIC
low complexity region	1354	1366	N/A	INTRINSIC
low complexity region	1445	1464	N/A	INTRINSIC
low complexity region	1482	1495	N/A	INTRINSIC
HMG	1564	1628	2.64e-3	SMART
low complexity region	1633	1649	N/A	INTRINSIC
coiled coil region	1670	1714	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.2%

Validation Efficiency

99% (87/88)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the myeloid/lymphoid or mixed-lineage leukemia (MLL) family and encodes a nuclear protein with an AT hook DNA-binding domain, a DHHC-type zinc finger, six PHD-type zinc fingers, a SET domain, a post-SET domain and a RING-type zinc finger. This protein is a member of the ASC-2/NCOA6 complex (ASCOM), which possesses histone methylation activity and is involved in transcriptional coactivation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele display partial embryonic lethality, delayed eyelid opening, postnatal growth retardation, impaired fertility in both sexes, and decreased proliferation of cultured mouse embryonic fibroblasts. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 90 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abr	A	G	11: 76,451,927	C585R	possibly damaging	Het
Acaca	T	C	11: 84,311,319	L1380S	probably damaging	Het
Aifm2	A	C	10: 61,727,726	Q125P	probably null	Het
Ak5	A	T	3: 152,472,932	L482*	probably null	Het
Aldh3a2	T	C	11: 61,248,932	Q458R	probably benign	Het
Ank2	G	A	3: 127,016,916	T524I		Het
Apoc3	A	T	9: 46,235,183	S25T	unknown	Het
Ash1l	A	T	3: 89,058,541	R2417*	probably null	Het
Bbs12	A	G	3: 37,319,056		probably benign	Het
Birc6	T	A	17: 74,612,151	I1992N		Het
Brd9	G	A	13: 73,944,787	V299M	probably damaging	Het
Brwd1	A	T	16: 96,064,930	N217K	probably damaging	Het
C3	T	C	17: 57,211,678	Y1235C	probably damaging	Het
Cacna1c	T	C	6: 118,613,946	Y1538C		Het
Ccdc172	T	A	19: 58,537,347	H212Q	possibly damaging	Het
Cdc6	A	G	11: 98,912,173	D313G	probably damaging	Het
Cyp2e1	T	C	7: 140,773,109	V353A	probably damaging	Het
Dlg2	G	T	7: 92,431,050	V711F	probably damaging	Het
Dmac2	T	C	7: 25,621,023	F49S	probably damaging	Het
Dnah7b	A	G	1: 46,134,514	K660E	probably benign	Het
Dusp8	A	T	7: 142,088,418	S106T	probably benign	Het
Dynll1	T	A	5: 115,300,545	I34F	probably benign	Het
Epb41l4b	A	G	4: 57,103,447	F130L	possibly damaging	Het
Erc2	T	C	14: 28,029,461	Y705H	probably benign	Het
Exosc8	T	A	3: 54,731,082	L160F	probably damaging	Het
F5	A	G	1: 164,174,261	T178A	probably benign	Het
F7	C	A	8: 13,035,059	P362T	probably damaging	Het
Fkbp3	T	C	12: 65,065,793	K156E	possibly damaging	Het
Folh1	G	A	7: 86,719,705	T738I	probably benign	Het
Gatad2b	C	T	3: 90,348,629	A134V	probably benign	Het
Glud1	T	A	14: 34,335,392	W338R		Het
Gm21149	T	C	5: 15,475,263	K62E	possibly damaging	Het
Gm32742	A	G	9: 51,138,749	Y1517H	probably damaging	Het
Grik5	G	A	7: 25,068,004		probably benign	Het
Gse1	A	T	8: 120,568,313	E391V	unknown	Het
Gxylt2	C	T	6: 100,733,368	Q157*	probably null	Het
Hbq1b	C	T	11: 32,287,092	T27I	probably damaging	Het
Hoxd13	T	A	2: 74,669,038	D243E	probably benign	Het
Hsd3b3	T	A	3: 98,743,895	I80F	possibly damaging	Het
Hsf2bp	A	T	17: 32,011,108		probably benign	Het
Itch	G	A	2: 155,210,125		probably benign	Het
Kat14	T	C	2: 144,373,822	F76L	probably benign	Het
Kdm6b	T	C	11: 69,404,598	T948A	unknown	Het
Lrp1	T	C	10: 127,546,412	T3727A	probably benign	Het
Lrrc8a	A	G	2: 30,257,030	I619V	possibly damaging	Het
Mansc1	C	A	6: 134,609,988	G409W	probably damaging	Het
Map3k11	C	A	19: 5,696,010	L418I	possibly damaging	Het
Mettl4	T	A	17: 94,735,485	I308L	possibly damaging	Het
Myo9a	A	G	9: 59,832,231	D742G	probably damaging	Het
Mypn	T	C	10: 63,192,873	Q137R	probably benign	Het
Neurod4	A	T	10: 130,270,558	Y282*	probably null	Het
Nup210	A	G	6: 91,043,817	F965S	probably benign	Het
Olfr1031	T	G	2: 85,992,475	Y219*	probably null	Het
Olfr1271	A	G	2: 90,266,014	C139R	probably damaging	Het
Olfr374	G	T	8: 72,109,853	G96C	probably damaging	Het
Olfr780	A	G	10: 129,322,028	N135S	probably benign	Het
Oplah	T	C	15: 76,300,898	T872A	possibly damaging	Het
Pkn2	A	T	3: 142,809,484	D696E	possibly damaging	Het
Pla2r1	A	T	2: 60,495,385		probably benign	Het
Plpp1	A	T	13: 112,851,504	I54L		Het
Ppp4r2	T	G	6: 100,865,152	N191K	probably damaging	Het
Ptpdc1	G	T	13: 48,586,179	P592Q	probably benign	Het
Qrich2	A	T	11: 116,456,866	L1044*	probably null	Het
Rb1cc1	A	G	1: 6,244,885	I421V	probably damaging	Het
Ripor3	A	T	2: 167,981,347	C881*	probably null	Het
Rreb1	T	C	13: 37,930,306	F547S	probably benign	Het
Scel	T	C	14: 103,533,310	V60A	probably benign	Het
Shank3	G	A	15: 89,558,216	A1771T	probably benign	Het
Slc6a20a	A	G	9: 123,640,566		probably null	Het
Slfn5	C	T	11: 82,960,620	T581I	probably damaging	Het
Ssh3	A	C	19: 4,264,085	V412G	probably damaging	Het
Stx17	T	G	4: 48,159,071		probably benign	Het
Sun3	T	G	11: 9,018,170	T274P	probably benign	Het
Tm9sf1	T	C	14: 55,638,007	T427A	probably damaging	Het
Tmem114	T	A	16: 8,412,119	I140F		Het
Tmem40	T	C	6: 115,734,019	R167G	possibly damaging	Het
Top3a	C	A	11: 60,750,575		probably null	Het
Trafd1	A	G	5: 121,378,510	V210A	probably benign	Het
Trim66	T	C	7: 109,477,689	I348V	possibly damaging	Het
Ttn	G	A	2: 76,848,828	A10850V	unknown	Het
Unc80	G	A	1: 66,638,085	A2058T	possibly damaging	Het
Upp2	T	C	2: 58,778,008	Y238H	probably damaging	Het
Vmn1r224	T	A	17: 20,419,980	I273N	probably damaging	Het
Vps13c	T	C	9: 67,929,523	S1768P	probably damaging	Het
Zfp26	G	A	9: 20,437,427	H614Y	probably damaging	Het
Zfp263	C	T	16: 3,749,837	T672I	probably benign	Het
Zfp641	T	A	15: 98,288,851	Q297L	probably benign	Het
Zfp944	T	C	17: 22,341,050	E25G	probably damaging	Het
Zfp994	T	C	17: 22,200,000	E656G	unknown	Het
Zfyve19	A	G	2: 119,214,849	D206G	probably damaging	Het

Other mutations in Kmt2c

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00436:Kmt2c	APN	5	25281261	missense	probably damaging	0.99
IGL00694:Kmt2c	APN	5	25293161	missense	probably damaging	0.99
IGL00780:Kmt2c	APN	5	25311051	missense	probably benign	0.00
IGL00811:Kmt2c	APN	5	25374533	missense	possibly damaging	0.75
IGL00885:Kmt2c	APN	5	25409171	missense	possibly damaging	0.80
IGL00948:Kmt2c	APN	5	25377161	missense	probably benign	0.08
IGL00959:Kmt2c	APN	5	25276229	missense	probably damaging	1.00
IGL01022:Kmt2c	APN	5	25302701	unclassified	probably benign
IGL01146:Kmt2c	APN	5	25308512	missense	probably damaging	0.96
IGL01154:Kmt2c	APN	5	25284399	missense	probably damaging	1.00
IGL01434:Kmt2c	APN	5	25409308	missense	probably damaging	1.00
IGL01464:Kmt2c	APN	5	25352244	missense	possibly damaging	0.90
IGL01525:Kmt2c	APN	5	25329441	splice site	probably benign
IGL01530:Kmt2c	APN	5	25313500	missense	probably benign	0.08
IGL01550:Kmt2c	APN	5	25281276	missense	probably damaging	1.00
IGL01598:Kmt2c	APN	5	25273666	makesense	probably null
IGL01598:Kmt2c	APN	5	25354771	missense	probably damaging	1.00
IGL01608:Kmt2c	APN	5	25354811	missense	probably damaging	0.97
IGL01663:Kmt2c	APN	5	25310670	missense	probably damaging	1.00
IGL01707:Kmt2c	APN	5	25300098	missense	probably damaging	1.00
IGL01714:Kmt2c	APN	5	25313400	missense	probably benign
IGL01784:Kmt2c	APN	5	25313526	missense	probably damaging	1.00
IGL01813:Kmt2c	APN	5	25290804	missense	possibly damaging	0.82
IGL01825:Kmt2c	APN	5	25310596	missense	probably damaging	1.00
IGL01834:Kmt2c	APN	5	25395455	missense	probably benign	0.05
IGL02072:Kmt2c	APN	5	25405432	missense	possibly damaging	0.96
IGL02159:Kmt2c	APN	5	25311343	missense	probably benign	0.18
IGL02303:Kmt2c	APN	5	25310157	missense	probably damaging	0.96
IGL02417:Kmt2c	APN	5	25373020	missense	probably benign
IGL02578:Kmt2c	APN	5	25366200	intron	probably benign
IGL02811:Kmt2c	APN	5	25315028	nonsense	probably null
IGL02943:Kmt2c	APN	5	25290823	missense	probably damaging	1.00
IGL03000:Kmt2c	APN	5	25284172	missense	probably damaging	1.00
IGL03040:Kmt2c	APN	5	25310352	missense	probably benign
IGL03076:Kmt2c	APN	5	25299151	nonsense	probably null
IGL03088:Kmt2c	APN	5	25299804	missense	probably damaging	0.99
IGL03131:Kmt2c	APN	5	25315361	missense	probably benign	0.00
FR4304:Kmt2c	UTSW	5	25315766	small insertion	probably benign
FR4976:Kmt2c	UTSW	5	25315763	small insertion	probably benign
PIT4520001:Kmt2c	UTSW	5	25315666	missense	probably benign	0.12
PIT4585001:Kmt2c	UTSW	5	25315106	missense	probably benign	0.21
R0313:Kmt2c	UTSW	5	25344930	missense	probably damaging	1.00
R0374:Kmt2c	UTSW	5	25309708	missense	probably damaging	1.00
R0411:Kmt2c	UTSW	5	25375957	missense	probably damaging	1.00
R0422:Kmt2c	UTSW	5	25315664	missense	probably benign
R0453:Kmt2c	UTSW	5	25354747	missense	probably damaging	1.00
R0616:Kmt2c	UTSW	5	25299252	missense	probably benign
R0619:Kmt2c	UTSW	5	25298916	missense	probably benign	0.21
R0671:Kmt2c	UTSW	5	25404365	missense	probably damaging	1.00
R0736:Kmt2c	UTSW	5	25295434	missense	probably benign
R0745:Kmt2c	UTSW	5	25359698	splice site	probably null
R0760:Kmt2c	UTSW	5	25353317	missense	possibly damaging	0.68
R0784:Kmt2c	UTSW	5	25310895	missense	probably benign	0.00
R0882:Kmt2c	UTSW	5	25295607	missense	possibly damaging	0.90
R0893:Kmt2c	UTSW	5	25351270	splice site	probably benign
R0942:Kmt2c	UTSW	5	25315303	missense	probably benign	0.10
R1110:Kmt2c	UTSW	5	25314362	missense	probably benign	0.01
R1137:Kmt2c	UTSW	5	25310983	missense	possibly damaging	0.80
R1255:Kmt2c	UTSW	5	25351153	missense	probably damaging	1.00
R1300:Kmt2c	UTSW	5	25405454	missense	probably damaging	0.99
R1497:Kmt2c	UTSW	5	25314515	missense	possibly damaging	0.80
R1594:Kmt2c	UTSW	5	25314878	missense	probably benign	0.01
R1611:Kmt2c	UTSW	5	25359311	critical splice donor site	probably null
R1617:Kmt2c	UTSW	5	25375927	missense	probably benign	0.01
R1720:Kmt2c	UTSW	5	25299184	missense	probably benign	0.05
R1723:Kmt2c	UTSW	5	25315005	missense	probably damaging	1.00
R1724:Kmt2c	UTSW	5	25315005	missense	probably damaging	1.00
R1726:Kmt2c	UTSW	5	25315005	missense	probably damaging	1.00
R1736:Kmt2c	UTSW	5	25290527	missense	probably damaging	1.00
R1778:Kmt2c	UTSW	5	25372974	missense	probably benign	0.02
R1809:Kmt2c	UTSW	5	25284192	missense	probably damaging	1.00
R1845:Kmt2c	UTSW	5	25373436	missense	probably benign	0.45
R1895:Kmt2c	UTSW	5	25315154	missense	probably benign	0.34
R1946:Kmt2c	UTSW	5	25315154	missense	probably benign	0.34
R1989:Kmt2c	UTSW	5	25498544	missense	possibly damaging	0.93
R2039:Kmt2c	UTSW	5	25329040	missense	possibly damaging	0.53
R2049:Kmt2c	UTSW	5	25285079	missense	probably damaging	1.00
R2079:Kmt2c	UTSW	5	25352280	missense	possibly damaging	0.82
R2080:Kmt2c	UTSW	5	25354717	missense	probably damaging	1.00
R2107:Kmt2c	UTSW	5	25309824	missense	probably benign	0.01
R2186:Kmt2c	UTSW	5	25287112	missense	probably damaging	1.00
R2395:Kmt2c	UTSW	5	25315152	missense	probably benign
R2983:Kmt2c	UTSW	5	25315757	small deletion	probably benign
R3109:Kmt2c	UTSW	5	25275735	missense	probably damaging	1.00
R3500:Kmt2c	UTSW	5	25299479	missense	probably benign	0.02
R3738:Kmt2c	UTSW	5	25405383	missense	probably benign	0.41
R3809:Kmt2c	UTSW	5	25409138	missense	possibly damaging	0.87
R4088:Kmt2c	UTSW	5	25287713	missense	probably benign
R4107:Kmt2c	UTSW	5	25298920	missense	possibly damaging	0.51
R4212:Kmt2c	UTSW	5	25347359	critical splice donor site	probably null
R4376:Kmt2c	UTSW	5	25315326	missense	probably benign	0.00
R4377:Kmt2c	UTSW	5	25315326	missense	probably benign	0.00
R4383:Kmt2c	UTSW	5	25351062	missense	possibly damaging	0.77
R4435:Kmt2c	UTSW	5	25314877	missense	possibly damaging	0.63
R4456:Kmt2c	UTSW	5	25310212	missense	probably benign
R4461:Kmt2c	UTSW	5	25299876	missense	probably benign	0.00
R4519:Kmt2c	UTSW	5	25363477	missense	probably damaging	1.00
R4550:Kmt2c	UTSW	5	25300174	missense	probably damaging	1.00
R4557:Kmt2c	UTSW	5	25300315	missense	probably damaging	1.00
R4610:Kmt2c	UTSW	5	25354384	missense	probably damaging	1.00
R4671:Kmt2c	UTSW	5	25366177	missense	probably damaging	1.00
R4704:Kmt2c	UTSW	5	25314027	nonsense	probably null
R4781:Kmt2c	UTSW	5	25443825	missense	probably damaging	1.00
R4844:Kmt2c	UTSW	5	25315113	missense	probably benign
R4855:Kmt2c	UTSW	5	25314557	missense	probably benign	0.00
R4919:Kmt2c	UTSW	5	25314395	missense	possibly damaging	0.80
R4971:Kmt2c	UTSW	5	25310872	missense	probably benign	0.00
R4983:Kmt2c	UTSW	5	25295511	missense	possibly damaging	0.51
R5012:Kmt2c	UTSW	5	25299712	nonsense	probably null
R5033:Kmt2c	UTSW	5	25314708	missense	probably benign	0.03
R5093:Kmt2c	UTSW	5	25409207	missense	probably benign	0.17
R5125:Kmt2c	UTSW	5	25284381	missense	probably damaging	0.99
R5231:Kmt2c	UTSW	5	25315473	missense	possibly damaging	0.89
R5254:Kmt2c	UTSW	5	25314594	missense	probably benign	0.01
R5396:Kmt2c	UTSW	5	25294734	splice site	probably null
R5415:Kmt2c	UTSW	5	25314701	missense	probably benign	0.21
R5523:Kmt2c	UTSW	5	25299339	missense	probably benign	0.00
R5554:Kmt2c	UTSW	5	25294610	missense	probably damaging	1.00
R5701:Kmt2c	UTSW	5	25314017	missense	probably benign	0.16
R5762:Kmt2c	UTSW	5	25310457	missense	probably benign	0.01
R5819:Kmt2c	UTSW	5	25409132	critical splice donor site	probably null
R5838:Kmt2c	UTSW	5	25284471	missense	probably damaging	1.00
R5912:Kmt2c	UTSW	5	25347469	missense	possibly damaging	0.80
R5951:Kmt2c	UTSW	5	25330803	missense	probably benign	0.15
R5988:Kmt2c	UTSW	5	25311120	missense	probably benign	0.02
R5999:Kmt2c	UTSW	5	25284205	missense	probably damaging	1.00
R6104:Kmt2c	UTSW	5	25299129	missense	probably benign
R6254:Kmt2c	UTSW	5	25349874	missense	possibly damaging	0.94
R6311:Kmt2c	UTSW	5	25443818	critical splice donor site	probably null
R6329:Kmt2c	UTSW	5	25315602	missense	probably benign	0.01
R6347:Kmt2c	UTSW	5	25310835	missense	possibly damaging	0.54
R6364:Kmt2c	UTSW	5	25309636	missense	probably null	0.99
R6379:Kmt2c	UTSW	5	25359341	missense	probably damaging	1.00
R6588:Kmt2c	UTSW	5	25323789	missense	probably damaging	0.99
R6628:Kmt2c	UTSW	5	25298928	missense	probably benign
R6733:Kmt2c	UTSW	5	25409293	missense	probably damaging	1.00
R6787:Kmt2c	UTSW	5	25275739	splice site	probably null
R6816:Kmt2c	UTSW	5	25405532	splice site	probably null
R6862:Kmt2c	UTSW	5	25310517	missense	probably damaging	1.00
R7150:Kmt2c	UTSW	5	25300362	missense	possibly damaging	0.89
R7220:Kmt2c	UTSW	5	25344925	missense	probably damaging	1.00
R7250:Kmt2c	UTSW	5	25299491	missense	probably damaging	1.00
R7250:Kmt2c	UTSW	5	25309807	missense	probably benign	0.00
R7402:Kmt2c	UTSW	5	25395420	missense	probably damaging	1.00
R7465:Kmt2c	UTSW	5	25302849	missense	probably damaging	1.00
R7467:Kmt2c	UTSW	5	25308532	missense	probably damaging	1.00
R7491:Kmt2c	UTSW	5	25284564	missense	probably damaging	0.99
R7549:Kmt2c	UTSW	5	25414970	missense	possibly damaging	0.95
R7637:Kmt2c	UTSW	5	25315095	missense	probably damaging	1.00
R7652:Kmt2c	UTSW	5	25315719	missense	probably benign	0.01
R7714:Kmt2c	UTSW	5	25375366	missense	probably benign
R7838:Kmt2c	UTSW	5	25294699	missense	possibly damaging	0.57
R7891:Kmt2c	UTSW	5	25300111	missense	probably damaging	1.00
R7892:Kmt2c	UTSW	5	25299816	missense	probably benign	0.18
R7895:Kmt2c	UTSW	5	25373176	missense	possibly damaging	0.65
R7960:Kmt2c	UTSW	5	25315196	missense	probably benign	0.01
R7974:Kmt2c	UTSW	5	25300563	missense	probably damaging	1.00
R7978:Kmt2c	UTSW	5	25359678	missense	probably benign	0.00
R8011:Kmt2c	UTSW	5	25351234	missense	probably damaging	0.99
R8021:Kmt2c	UTSW	5	25287119	missense	possibly damaging	0.88
R8022:Kmt2c	UTSW	5	25281680	missense	possibly damaging	0.83
R8079:Kmt2c	UTSW	5	25302732	missense	probably damaging	0.98
R8087:Kmt2c	UTSW	5	25329252	missense	probably damaging	1.00
R8109:Kmt2c	UTSW	5	25281384	missense	probably damaging	1.00
R8161:Kmt2c	UTSW	5	25374564	missense	probably benign	0.00
R8169:Kmt2c	UTSW	5	25354687	missense	probably damaging	1.00
R8206:Kmt2c	UTSW	5	25314539	missense	probably damaging	0.98
R8218:Kmt2c	UTSW	5	25283106	missense	probably damaging	1.00
R8223:Kmt2c	UTSW	5	25324218	missense	possibly damaging	0.89
R8260:Kmt2c	UTSW	5	25405516	missense	possibly damaging	0.87
R8330:Kmt2c	UTSW	5	25304694	missense	probably null	1.00
R8355:Kmt2c	UTSW	5	25354501	critical splice acceptor site	probably null
R8455:Kmt2c	UTSW	5	25354501	critical splice acceptor site	probably null
R8508:Kmt2c	UTSW	5	25314122	missense	probably benign	0.34
R8885:Kmt2c	UTSW	5	25315079	missense	probably benign	0.34
R8907:Kmt2c	UTSW	5	25309611	missense	probably damaging	1.00
R8924:Kmt2c	UTSW	5	25298887	missense	probably benign
R8969:Kmt2c	UTSW	5	25314389	missense	possibly damaging	0.82
R9019:Kmt2c	UTSW	5	25283210	missense	probably damaging	1.00
R9035:Kmt2c	UTSW	5	25319012	missense	probably damaging	1.00
R9074:Kmt2c	UTSW	5	25284345	missense	probably damaging	1.00
R9125:Kmt2c	UTSW	5	25284196	missense	possibly damaging	0.86
R9171:Kmt2c	UTSW	5	25281311	missense	probably damaging	1.00
R9235:Kmt2c	UTSW	5	25299999	missense	probably damaging	1.00
R9288:Kmt2c	UTSW	5	25292909	missense	probably damaging	1.00
R9288:Kmt2c	UTSW	5	25349862	missense	probably benign	0.34
R9336:Kmt2c	UTSW	5	25409167	missense	probably benign	0.06
R9443:Kmt2c	UTSW	5	25310047	missense	probably damaging	1.00
R9481:Kmt2c	UTSW	5	25292909	missense	probably damaging	1.00
R9481:Kmt2c	UTSW	5	25349862	missense	probably benign	0.34
R9526:Kmt2c	UTSW	5	25281357	missense	probably damaging	1.00
R9653:Kmt2c	UTSW	5	25302821	missense	probably damaging	1.00
R9729:Kmt2c	UTSW	5	25284760	missense	probably damaging	1.00
R9731:Kmt2c	UTSW	5	25372958	missense	probably benign	0.18
R9784:Kmt2c	UTSW	5	25344961	missense	probably damaging	1.00
RF001:Kmt2c	UTSW	5	25315775	small insertion	probably benign
RF006:Kmt2c	UTSW	5	25315772	small insertion	probably benign
RF011:Kmt2c	UTSW	5	25338459	missense	probably damaging	1.00
RF041:Kmt2c	UTSW	5	25315775	small insertion	probably benign
RF047:Kmt2c	UTSW	5	25315760	small insertion	probably benign
RF051:Kmt2c	UTSW	5	25313479	unclassified	probably benign
RF055:Kmt2c	UTSW	5	25315772	small insertion	probably benign
RF059:Kmt2c	UTSW	5	25313479	unclassified	probably benign
RF063:Kmt2c	UTSW	5	25315764	small insertion	probably benign
X0024:Kmt2c	UTSW	5	25405485	missense	probably benign	0.26
X0027:Kmt2c	UTSW	5	25330887	missense	possibly damaging	0.90
Z1176:Kmt2c	UTSW	5	25354413	missense	probably damaging	1.00
Z1177:Kmt2c	UTSW	5	25295397	critical splice donor site	probably null
Z1177:Kmt2c	UTSW	5	25300003	missense	probably benign	0.00
Z1177:Kmt2c	UTSW	5	25366197	critical splice acceptor site	probably null

Predicted Primers

PCR Primer
(F):5'- AGGTGCCTCAGAAAATTCACC -3'
(R):5'- CCCACCATTAAATAATCCAGTTGG -3'

Sequencing Primer
(F):5'- CACTTAAAGGATGATTTAGGGGCCTC -3'
(R):5'- AATAATCCAGTTGGGCTTCCTCAG -3'

Posted On

2022-01-20