Incidental Mutation 'R9130:Sun3'
ID 693560
Institutional Source Beutler Lab
Gene Symbol Sun3
Ensembl Gene ENSMUSG00000040985
Gene Name Sad1 and UNC84 domain containing 3
Synonyms Sunc1, D630047F21Rik
MMRRC Submission 068928-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.052) question?
Stock # R9130 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 8966054-8998991 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 8968170 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Proline at position 274 (T274P)
Ref Sequence ENSEMBL: ENSMUSP00000045199 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043377] [ENSMUST00000102909]
AlphaFold Q5SS91
Predicted Effect probably benign
Transcript: ENSMUST00000043377
AA Change: T274P

PolyPhen 2 Score 0.126 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000045199
Gene: ENSMUSG00000040985
AA Change: T274P

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:Sad1_UNC 182 316 3.4e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102909
AA Change: T214P

PolyPhen 2 Score 0.126 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000099973
Gene: ENSMUSG00000040985
AA Change: T214P

DomainStartEndE-ValueType
Pfam:Sad1_UNC 122 256 3.2e-48 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 99% (87/88)
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abr A G 11: 76,342,753 (GRCm39) C585R possibly damaging Het
Acaca T C 11: 84,202,145 (GRCm39) L1380S probably damaging Het
Aifm2 A C 10: 61,563,505 (GRCm39) Q125P probably null Het
Ak5 A T 3: 152,178,569 (GRCm39) L482* probably null Het
Aldh3a2 T C 11: 61,139,758 (GRCm39) Q458R probably benign Het
Ank2 G A 3: 126,810,565 (GRCm39) T524I Het
Apoc3 A T 9: 46,146,481 (GRCm39) S25T unknown Het
Ash1l A T 3: 88,965,848 (GRCm39) R2417* probably null Het
Bbs12 A G 3: 37,373,205 (GRCm39) probably benign Het
Birc6 T A 17: 74,919,146 (GRCm39) I1992N Het
Brd9 G A 13: 74,092,906 (GRCm39) V299M probably damaging Het
Brwd1 A T 16: 95,866,130 (GRCm39) N217K probably damaging Het
C3 T C 17: 57,518,678 (GRCm39) Y1235C probably damaging Het
Cacna1c T C 6: 118,590,907 (GRCm39) Y1538C Het
Ccdc172 T A 19: 58,525,779 (GRCm39) H212Q possibly damaging Het
Cdc6 A G 11: 98,802,999 (GRCm39) D313G probably damaging Het
Cyp2e1 T C 7: 140,353,022 (GRCm39) V353A probably damaging Het
Dlg2 G T 7: 92,080,258 (GRCm39) V711F probably damaging Het
Dmac2 T C 7: 25,320,448 (GRCm39) F49S probably damaging Het
Dnah7b A G 1: 46,173,674 (GRCm39) K660E probably benign Het
Dusp8 A T 7: 141,642,155 (GRCm39) S106T probably benign Het
Dynll1 T A 5: 115,438,604 (GRCm39) I34F probably benign Het
Epb41l4b A G 4: 57,103,447 (GRCm39) F130L possibly damaging Het
Erc2 T C 14: 27,751,418 (GRCm39) Y705H probably benign Het
Exosc8 T A 3: 54,638,503 (GRCm39) L160F probably damaging Het
F5 A G 1: 164,001,830 (GRCm39) T178A probably benign Het
F7 C A 8: 13,085,059 (GRCm39) P362T probably damaging Het
Fkbp3 T C 12: 65,112,567 (GRCm39) K156E possibly damaging Het
Folh1 G A 7: 86,368,913 (GRCm39) T738I probably benign Het
Gatad2b C T 3: 90,255,936 (GRCm39) A134V probably benign Het
Glud1 T A 14: 34,057,349 (GRCm39) W338R Het
Gm21149 T C 5: 15,680,261 (GRCm39) K62E possibly damaging Het
Gm32742 A G 9: 51,050,049 (GRCm39) Y1517H probably damaging Het
Grik5 G A 7: 24,767,429 (GRCm39) probably benign Het
Gse1 A T 8: 121,295,052 (GRCm39) E391V unknown Het
Gxylt2 C T 6: 100,710,329 (GRCm39) Q157* probably null Het
Hbq1b C T 11: 32,237,092 (GRCm39) T27I probably damaging Het
Hoxd13 T A 2: 74,499,382 (GRCm39) D243E probably benign Het
Hsd3b3 T A 3: 98,651,211 (GRCm39) I80F possibly damaging Het
Hsf2bp A T 17: 32,230,082 (GRCm39) probably benign Het
Itch G A 2: 155,052,045 (GRCm39) probably benign Het
Kat14 T C 2: 144,215,742 (GRCm39) F76L probably benign Het
Kdm6b T C 11: 69,295,424 (GRCm39) T948A unknown Het
Kmt2c A T 5: 25,516,102 (GRCm39) H2580Q probably benign Het
Lrp1 T C 10: 127,382,281 (GRCm39) T3727A probably benign Het
Lrrc8a A G 2: 30,147,042 (GRCm39) I619V possibly damaging Het
Mansc1 C A 6: 134,586,951 (GRCm39) G409W probably damaging Het
Map3k11 C A 19: 5,746,038 (GRCm39) L418I possibly damaging Het
Mettl4 T A 17: 95,042,913 (GRCm39) I308L possibly damaging Het
Myo9a A G 9: 59,739,514 (GRCm39) D742G probably damaging Het
Mypn T C 10: 63,028,652 (GRCm39) Q137R probably benign Het
Neurod4 A T 10: 130,106,427 (GRCm39) Y282* probably null Het
Nup210 A G 6: 91,020,799 (GRCm39) F965S probably benign Het
Oplah T C 15: 76,185,098 (GRCm39) T872A possibly damaging Het
Or1ab2 G T 8: 72,863,697 (GRCm39) G96C probably damaging Het
Or4b12 A G 2: 90,096,358 (GRCm39) C139R probably damaging Het
Or5m8 T G 2: 85,822,819 (GRCm39) Y219* probably null Het
Or6c68 A G 10: 129,157,897 (GRCm39) N135S probably benign Het
Pkn2 A T 3: 142,515,245 (GRCm39) D696E possibly damaging Het
Pla2r1 A T 2: 60,325,729 (GRCm39) probably benign Het
Plpp1 A T 13: 112,988,038 (GRCm39) I54L Het
Ppp4r2 T G 6: 100,842,113 (GRCm39) N191K probably damaging Het
Ptpdc1 G T 13: 48,739,655 (GRCm39) P592Q probably benign Het
Qrich2 A T 11: 116,347,692 (GRCm39) L1044* probably null Het
Rb1cc1 A G 1: 6,315,109 (GRCm39) I421V probably damaging Het
Ripor3 A T 2: 167,823,267 (GRCm39) C881* probably null Het
Rreb1 T C 13: 38,114,282 (GRCm39) F547S probably benign Het
Scel T C 14: 103,770,746 (GRCm39) V60A probably benign Het
Shank3 G A 15: 89,442,419 (GRCm39) A1771T probably benign Het
Slc6a20a A G 9: 123,469,631 (GRCm39) probably null Het
Slfn5 C T 11: 82,851,446 (GRCm39) T581I probably damaging Het
Ssh3 A C 19: 4,314,113 (GRCm39) V412G probably damaging Het
Stx17 T G 4: 48,159,071 (GRCm39) probably benign Het
Tm9sf1 T C 14: 55,875,464 (GRCm39) T427A probably damaging Het
Tmem114 T A 16: 8,229,983 (GRCm39) I140F Het
Tmem40 T C 6: 115,710,980 (GRCm39) R167G possibly damaging Het
Top3a C A 11: 60,641,401 (GRCm39) probably null Het
Trafd1 A G 5: 121,516,573 (GRCm39) V210A probably benign Het
Trim66 T C 7: 109,076,896 (GRCm39) I348V possibly damaging Het
Ttn G A 2: 76,679,172 (GRCm39) A10850V unknown Het
Unc80 G A 1: 66,677,244 (GRCm39) A2058T possibly damaging Het
Upp2 T C 2: 58,668,020 (GRCm39) Y238H probably damaging Het
Vmn1r224 T A 17: 20,640,242 (GRCm39) I273N probably damaging Het
Vps13c T C 9: 67,836,805 (GRCm39) S1768P probably damaging Het
Zfp26 G A 9: 20,348,723 (GRCm39) H614Y probably damaging Het
Zfp263 C T 16: 3,567,701 (GRCm39) T672I probably benign Het
Zfp641 T A 15: 98,186,732 (GRCm39) Q297L probably benign Het
Zfp944 T C 17: 22,560,031 (GRCm39) E25G probably damaging Het
Zfp994 T C 17: 22,418,981 (GRCm39) E656G unknown Het
Zfyve19 A G 2: 119,045,330 (GRCm39) D206G probably damaging Het
Other mutations in Sun3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01290:Sun3 APN 11 8,973,341 (GRCm39) missense possibly damaging 0.91
IGL01473:Sun3 APN 11 8,979,394 (GRCm39) missense probably benign 0.00
IGL01578:Sun3 APN 11 8,979,436 (GRCm39) missense probably damaging 0.98
IGL03340:Sun3 APN 11 8,973,285 (GRCm39) splice site probably benign
R1944:Sun3 UTSW 11 8,988,296 (GRCm39) missense probably benign 0.00
R1945:Sun3 UTSW 11 8,988,296 (GRCm39) missense probably benign 0.00
R2233:Sun3 UTSW 11 8,973,371 (GRCm39) nonsense probably null
R4356:Sun3 UTSW 11 8,966,328 (GRCm39) missense probably damaging 1.00
R4784:Sun3 UTSW 11 8,988,266 (GRCm39) missense probably benign 0.00
R4785:Sun3 UTSW 11 8,988,266 (GRCm39) missense probably benign 0.00
R4975:Sun3 UTSW 11 8,988,311 (GRCm39) nonsense probably null
R5022:Sun3 UTSW 11 8,988,314 (GRCm39) missense probably damaging 0.96
R5134:Sun3 UTSW 11 8,988,287 (GRCm39) missense probably benign 0.04
R5163:Sun3 UTSW 11 8,973,295 (GRCm39) missense possibly damaging 0.89
R5358:Sun3 UTSW 11 8,981,496 (GRCm39) missense possibly damaging 0.90
R5668:Sun3 UTSW 11 8,981,433 (GRCm39) critical splice donor site probably null
R6621:Sun3 UTSW 11 8,966,242 (GRCm39) missense probably damaging 1.00
R7442:Sun3 UTSW 11 8,981,445 (GRCm39) missense possibly damaging 0.75
R8022:Sun3 UTSW 11 8,973,376 (GRCm39) missense probably damaging 1.00
R8134:Sun3 UTSW 11 8,979,346 (GRCm39) missense probably benign 0.00
R9454:Sun3 UTSW 11 8,988,281 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- GCAAACTGAATTGTGCATGTG -3'
(R):5'- CATGCAATATCAAGTGAACCATTGC -3'

Sequencing Primer
(F):5'- ATACATGCCAGTGTTTGAAGC -3'
(R):5'- CAAGTGAACCATTGCTACTTGAG -3'
Posted On 2022-01-20