Incidental Mutation 'R9130:Acaca'
ID 693567
Institutional Source Beutler Lab
Gene Symbol Acaca
Ensembl Gene ENSMUSG00000020532
Gene Name acetyl-Coenzyme A carboxylase alpha
Synonyms LOC327983, Acac, A530025K05Rik, acetyl-CoA carboxylase, Acc1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9130 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 84129672-84401651 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 84311319 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Serine at position 1380 (L1380S)
Ref Sequence ENSEMBL: ENSMUSP00000020843 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020843] [ENSMUST00000103201] [ENSMUST00000183887]
AlphaFold Q5SWU9
Predicted Effect probably damaging
Transcript: ENSMUST00000020843
AA Change: L1380S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000020843
Gene: ENSMUSG00000020532
AA Change: L1380S

DomainStartEndE-ValueType
Pfam:CPSase_L_chain 116 236 4.7e-33 PFAM
Pfam:CPSase_L_D2 272 472 2.5e-55 PFAM
Pfam:ATP-grasp 280 443 4.3e-7 PFAM
Pfam:ATP-grasp_4 282 442 1.9e-11 PFAM
Pfam:Dala_Dala_lig_C 284 440 5.4e-7 PFAM
Biotin_carb_C 506 613 3.76e-24 SMART
low complexity region 708 725 N/A INTRINSIC
Pfam:Biotin_lipoyl 751 817 9.8e-19 PFAM
Pfam:ACC_central 818 1568 2.1e-288 PFAM
Pfam:Carboxyl_trans 1668 2222 1.6e-185 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000103201
AA Change: L1380S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000099490
Gene: ENSMUSG00000020532
AA Change: L1380S

DomainStartEndE-ValueType
Pfam:CPSase_L_chain 116 236 6.7e-29 PFAM
Pfam:ATP-grasp_4 239 442 2e-15 PFAM
Pfam:CPSase_L_D2 272 472 3.3e-55 PFAM
Pfam:Dala_Dala_lig_C 279 440 3e-7 PFAM
Pfam:ATP-grasp 281 442 1.1e-6 PFAM
Biotin_carb_C 506 613 3.76e-24 SMART
low complexity region 708 725 N/A INTRINSIC
Pfam:Biotin_lipoyl 751 817 3.7e-18 PFAM
Pfam:ACC_central 818 1568 3.5e-253 PFAM
Pfam:Carboxyl_trans 1668 2222 2.7e-175 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000183887
AA Change: L201S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139378
Gene: ENSMUSG00000020532
AA Change: L201S

DomainStartEndE-ValueType
Pfam:ACC_central 1 228 8.6e-57 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 99% (87/88)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Acetyl-CoA carboxylase (ACC) is a complex multifunctional enzyme system. ACC is a biotin-containing enzyme which catalyzes the carboxylation of acetyl-CoA to malonyl-CoA, the rate-limiting step in fatty acid synthesis. There are two ACC forms, alpha and beta, encoded by two different genes. ACC-alpha is highly enriched in lipogenic tissues. The enzyme is under long term control at the transcriptional and translational levels and under short term regulation by the phosphorylation/dephosphorylation of targeted serine residues and by allosteric transformation by citrate or palmitoyl-CoA. Multiple alternatively spliced transcript variants divergent in the 5' sequence and encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display embryonic lethality before embryo turning with growth arrest at the egg cylinder stage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abr A G 11: 76,451,927 C585R possibly damaging Het
Aifm2 A C 10: 61,727,726 Q125P probably null Het
Ak5 A T 3: 152,472,932 L482* probably null Het
Aldh3a2 T C 11: 61,248,932 Q458R probably benign Het
Ank2 G A 3: 127,016,916 T524I Het
Apoc3 A T 9: 46,235,183 S25T unknown Het
Ash1l A T 3: 89,058,541 R2417* probably null Het
Bbs12 A G 3: 37,319,056 probably benign Het
Birc6 T A 17: 74,612,151 I1992N Het
Brd9 G A 13: 73,944,787 V299M probably damaging Het
Brwd1 A T 16: 96,064,930 N217K probably damaging Het
C3 T C 17: 57,211,678 Y1235C probably damaging Het
Cacna1c T C 6: 118,613,946 Y1538C Het
Ccdc172 T A 19: 58,537,347 H212Q possibly damaging Het
Cdc6 A G 11: 98,912,173 D313G probably damaging Het
Cyp2e1 T C 7: 140,773,109 V353A probably damaging Het
Dlg2 G T 7: 92,431,050 V711F probably damaging Het
Dmac2 T C 7: 25,621,023 F49S probably damaging Het
Dnah7b A G 1: 46,134,514 K660E probably benign Het
Dusp8 A T 7: 142,088,418 S106T probably benign Het
Dynll1 T A 5: 115,300,545 I34F probably benign Het
Epb41l4b A G 4: 57,103,447 F130L possibly damaging Het
Erc2 T C 14: 28,029,461 Y705H probably benign Het
Exosc8 T A 3: 54,731,082 L160F probably damaging Het
F5 A G 1: 164,174,261 T178A probably benign Het
F7 C A 8: 13,035,059 P362T probably damaging Het
Fkbp3 T C 12: 65,065,793 K156E possibly damaging Het
Folh1 G A 7: 86,719,705 T738I probably benign Het
Gatad2b C T 3: 90,348,629 A134V probably benign Het
Glud1 T A 14: 34,335,392 W338R Het
Gm21149 T C 5: 15,475,263 K62E possibly damaging Het
Gm32742 A G 9: 51,138,749 Y1517H probably damaging Het
Grik5 G A 7: 25,068,004 probably benign Het
Gse1 A T 8: 120,568,313 E391V unknown Het
Gxylt2 C T 6: 100,733,368 Q157* probably null Het
Hbq1b C T 11: 32,287,092 T27I probably damaging Het
Hoxd13 T A 2: 74,669,038 D243E probably benign Het
Hsd3b3 T A 3: 98,743,895 I80F possibly damaging Het
Hsf2bp A T 17: 32,011,108 probably benign Het
Itch G A 2: 155,210,125 probably benign Het
Kat14 T C 2: 144,373,822 F76L probably benign Het
Kdm6b T C 11: 69,404,598 T948A unknown Het
Kmt2c A T 5: 25,311,104 H2580Q probably benign Het
Lrp1 T C 10: 127,546,412 T3727A probably benign Het
Lrrc8a A G 2: 30,257,030 I619V possibly damaging Het
Mansc1 C A 6: 134,609,988 G409W probably damaging Het
Map3k11 C A 19: 5,696,010 L418I possibly damaging Het
Mettl4 T A 17: 94,735,485 I308L possibly damaging Het
Myo9a A G 9: 59,832,231 D742G probably damaging Het
Mypn T C 10: 63,192,873 Q137R probably benign Het
Neurod4 A T 10: 130,270,558 Y282* probably null Het
Nup210 A G 6: 91,043,817 F965S probably benign Het
Olfr1031 T G 2: 85,992,475 Y219* probably null Het
Olfr1271 A G 2: 90,266,014 C139R probably damaging Het
Olfr374 G T 8: 72,109,853 G96C probably damaging Het
Olfr780 A G 10: 129,322,028 N135S probably benign Het
Oplah T C 15: 76,300,898 T872A possibly damaging Het
Pkn2 A T 3: 142,809,484 D696E possibly damaging Het
Pla2r1 A T 2: 60,495,385 probably benign Het
Plpp1 A T 13: 112,851,504 I54L Het
Ppp4r2 T G 6: 100,865,152 N191K probably damaging Het
Ptpdc1 G T 13: 48,586,179 P592Q probably benign Het
Qrich2 A T 11: 116,456,866 L1044* probably null Het
Rb1cc1 A G 1: 6,244,885 I421V probably damaging Het
Ripor3 A T 2: 167,981,347 C881* probably null Het
Rreb1 T C 13: 37,930,306 F547S probably benign Het
Scel T C 14: 103,533,310 V60A probably benign Het
Shank3 G A 15: 89,558,216 A1771T probably benign Het
Slc6a20a A G 9: 123,640,566 probably null Het
Slfn5 C T 11: 82,960,620 T581I probably damaging Het
Ssh3 A C 19: 4,264,085 V412G probably damaging Het
Stx17 T G 4: 48,159,071 probably benign Het
Sun3 T G 11: 9,018,170 T274P probably benign Het
Tm9sf1 T C 14: 55,638,007 T427A probably damaging Het
Tmem114 T A 16: 8,412,119 I140F Het
Tmem40 T C 6: 115,734,019 R167G possibly damaging Het
Top3a C A 11: 60,750,575 probably null Het
Trafd1 A G 5: 121,378,510 V210A probably benign Het
Trim66 T C 7: 109,477,689 I348V possibly damaging Het
Ttn G A 2: 76,848,828 A10850V unknown Het
Unc80 G A 1: 66,638,085 A2058T possibly damaging Het
Upp2 T C 2: 58,778,008 Y238H probably damaging Het
Vmn1r224 T A 17: 20,419,980 I273N probably damaging Het
Vps13c T C 9: 67,929,523 S1768P probably damaging Het
Zfp26 G A 9: 20,437,427 H614Y probably damaging Het
Zfp263 C T 16: 3,749,837 T672I probably benign Het
Zfp641 T A 15: 98,288,851 Q297L probably benign Het
Zfp944 T C 17: 22,341,050 E25G probably damaging Het
Zfp994 T C 17: 22,200,000 E656G unknown Het
Zfyve19 A G 2: 119,214,849 D206G probably damaging Het
Other mutations in Acaca
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00544:Acaca APN 11 84278917 missense probably damaging 1.00
IGL01134:Acaca APN 11 84251279 missense probably benign 0.22
IGL01446:Acaca APN 11 84260631 missense probably damaging 1.00
IGL01591:Acaca APN 11 84243320 missense probably damaging 1.00
IGL01663:Acaca APN 11 84277802 missense possibly damaging 0.85
IGL01767:Acaca APN 11 84320542 missense probably benign 0.01
IGL02206:Acaca APN 11 84260747 nonsense probably null
IGL02335:Acaca APN 11 84214258 missense possibly damaging 0.84
IGL02477:Acaca APN 11 84307168 splice site probably benign
IGL02515:Acaca APN 11 84262403 missense probably benign
IGL02651:Acaca APN 11 84245204 splice site probably benign
IGL02805:Acaca APN 11 84223133 splice site probably benign
IGL03328:Acaca APN 11 84320529 missense probably benign 0.00
effervescence UTSW 11 84262474 missense probably benign 0.41
fizz UTSW 11 84245856 missense probably damaging 0.98
greenhouse UTSW 11 84338356 missense probably damaging 1.00
Serene UTSW 11 84311409 splice site probably null
Tranquil UTSW 11 84280461 missense probably damaging 1.00
vitamin UTSW 11 84280435 missense possibly damaging 0.78
ANU05:Acaca UTSW 11 84315852 missense probably damaging 1.00
R0385:Acaca UTSW 11 84231748 missense probably benign 0.01
R0518:Acaca UTSW 11 84290286 critical splice acceptor site probably null
R0536:Acaca UTSW 11 84280516 splice site probably benign
R0962:Acaca UTSW 11 84311303 missense probably damaging 1.00
R0968:Acaca UTSW 11 84239033 nonsense probably null
R1123:Acaca UTSW 11 84264080 missense probably benign 0.09
R1452:Acaca UTSW 11 84295059 splice site probably benign
R1478:Acaca UTSW 11 84372627 missense probably damaging 1.00
R1500:Acaca UTSW 11 84293984 missense probably benign 0.00
R1512:Acaca UTSW 11 84195469 missense probably benign 0.00
R1657:Acaca UTSW 11 84264084 missense probably benign 0.09
R1681:Acaca UTSW 11 84226185 missense probably damaging 1.00
R1682:Acaca UTSW 11 84392217 missense probably benign 0.23
R1688:Acaca UTSW 11 84238896 missense probably damaging 1.00
R1755:Acaca UTSW 11 84276564 frame shift probably null
R1775:Acaca UTSW 11 84300422 missense possibly damaging 0.56
R1793:Acaca UTSW 11 84315969 missense probably damaging 0.98
R1793:Acaca UTSW 11 84338393 missense probably damaging 1.00
R1855:Acaca UTSW 11 84371554 missense probably damaging 0.96
R1881:Acaca UTSW 11 84270387 nonsense probably null
R1881:Acaca UTSW 11 84300471 splice site probably benign
R1989:Acaca UTSW 11 84262529 missense probably damaging 0.98
R2147:Acaca UTSW 11 84276536 missense probably benign 0.03
R2215:Acaca UTSW 11 84363793 missense probably damaging 1.00
R2238:Acaca UTSW 11 84391505 splice site probably benign
R2252:Acaca UTSW 11 84371532 missense probably damaging 0.99
R2316:Acaca UTSW 11 84264080 missense probably benign 0.16
R2316:Acaca UTSW 11 84294983 missense possibly damaging 0.69
R2337:Acaca UTSW 11 84257197 missense possibly damaging 0.93
R2697:Acaca UTSW 11 84364413 missense probably damaging 1.00
R3551:Acaca UTSW 11 84261624 missense probably damaging 1.00
R3552:Acaca UTSW 11 84261624 missense probably damaging 1.00
R3748:Acaca UTSW 11 84311409 splice site probably null
R3844:Acaca UTSW 11 84364413 missense probably damaging 1.00
R3873:Acaca UTSW 11 84312721 unclassified probably benign
R4152:Acaca UTSW 11 84292926 missense possibly damaging 0.88
R4406:Acaca UTSW 11 84280449 missense probably benign 0.35
R4448:Acaca UTSW 11 84262492 missense probably damaging 1.00
R4642:Acaca UTSW 11 84280461 missense probably damaging 1.00
R4696:Acaca UTSW 11 84280435 missense possibly damaging 0.78
R4707:Acaca UTSW 11 84312854 missense probably damaging 0.96
R4710:Acaca UTSW 11 84392337 missense possibly damaging 0.84
R4775:Acaca UTSW 11 84243339 missense probably damaging 1.00
R4821:Acaca UTSW 11 84294987 missense possibly damaging 0.69
R4883:Acaca UTSW 11 84251290 missense probably benign 0.01
R4988:Acaca UTSW 11 84263295 missense probably damaging 1.00
R5034:Acaca UTSW 11 84245264 missense probably benign 0.00
R5255:Acaca UTSW 11 84311307 missense probably damaging 1.00
R5294:Acaca UTSW 11 84391519 missense probably benign 0.01
R5350:Acaca UTSW 11 84215873 missense probably damaging 0.99
R5437:Acaca UTSW 11 84346820 splice site probably null
R5664:Acaca UTSW 11 84243384 missense probably damaging 1.00
R5665:Acaca UTSW 11 84245294 nonsense probably null
R5959:Acaca UTSW 11 84215966 missense probably damaging 1.00
R6011:Acaca UTSW 11 84245744 missense probably benign 0.44
R6027:Acaca UTSW 11 84398177 missense probably benign
R6246:Acaca UTSW 11 84315970 missense probably benign 0.08
R6313:Acaca UTSW 11 84292929 missense probably benign 0.00
R6450:Acaca UTSW 11 84280468 missense probably damaging 0.98
R6623:Acaca UTSW 11 84371499 critical splice acceptor site probably null
R6736:Acaca UTSW 11 84238838 missense probably benign 0.05
R6752:Acaca UTSW 11 84195483 missense probably benign 0.44
R6807:Acaca UTSW 11 84391530 missense probably benign
R6826:Acaca UTSW 11 84195536 missense probably damaging 1.00
R7035:Acaca UTSW 11 84238943 missense probably damaging 1.00
R7078:Acaca UTSW 11 84263312 missense possibly damaging 0.91
R7088:Acaca UTSW 11 84278957 critical splice donor site probably null
R7201:Acaca UTSW 11 84262474 missense probably benign 0.41
R7261:Acaca UTSW 11 84368700 missense probably damaging 1.00
R7399:Acaca UTSW 11 84260679 missense possibly damaging 0.89
R7421:Acaca UTSW 11 84363736 missense possibly damaging 0.64
R7443:Acaca UTSW 11 84315793 missense probably benign 0.02
R7453:Acaca UTSW 11 84245310 missense probably benign
R7471:Acaca UTSW 11 84277782 splice site probably null
R7519:Acaca UTSW 11 84245856 missense probably damaging 0.98
R7537:Acaca UTSW 11 84260634 missense probably damaging 1.00
R7574:Acaca UTSW 11 84261588 missense probably benign
R7633:Acaca UTSW 11 84372639 missense probably benign 0.26
R7643:Acaca UTSW 11 84338356 missense probably damaging 1.00
R7664:Acaca UTSW 11 84245349 missense probably damaging 1.00
R7675:Acaca UTSW 11 84315916 missense probably benign 0.04
R7676:Acaca UTSW 11 84294987 missense possibly damaging 0.69
R7729:Acaca UTSW 11 84371513 missense probably damaging 0.98
R7867:Acaca UTSW 11 84249524 missense possibly damaging 0.88
R7898:Acaca UTSW 11 84364449 critical splice donor site probably null
R7909:Acaca UTSW 11 84245235 missense possibly damaging 0.56
R7915:Acaca UTSW 11 84276588 missense probably benign
R7956:Acaca UTSW 11 84320580 missense probably damaging 0.98
R8000:Acaca UTSW 11 84392231 missense possibly damaging 0.88
R8038:Acaca UTSW 11 84215904 missense probably damaging 1.00
R8545:Acaca UTSW 11 84345968 missense probably damaging 1.00
R8722:Acaca UTSW 11 84338457 missense possibly damaging 0.85
R9005:Acaca UTSW 11 84371584 missense probably damaging 0.99
R9397:Acaca UTSW 11 84368725 missense probably damaging 1.00
R9489:Acaca UTSW 11 84293016 missense probably benign 0.01
R9540:Acaca UTSW 11 84243411 missense probably damaging 1.00
R9593:Acaca UTSW 11 84380513 nonsense probably null
R9605:Acaca UTSW 11 84293016 missense probably benign 0.01
R9634:Acaca UTSW 11 84293990 missense probably benign 0.00
R9720:Acaca UTSW 11 84263357 missense probably damaging 1.00
RF014:Acaca UTSW 11 84231724 missense probably benign 0.01
X0027:Acaca UTSW 11 84292895 missense probably benign 0.01
X0060:Acaca UTSW 11 84264104 missense probably benign
X0067:Acaca UTSW 11 84368737 nonsense probably null
Z1176:Acaca UTSW 11 84260720 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAAGGTGTTCGGGCATGTCC -3'
(R):5'- ATACCCACCTTTGTGACCAGATC -3'

Sequencing Primer
(F):5'- TGAAACAGGGTTTAATCCTCCTACC -3'
(R):5'- CACCTTTGTGACCAGATCAGAGTG -3'
Posted On 2022-01-20