Incidental Mutation 'R9130:Scel'
ID 693578
Institutional Source Beutler Lab
Gene Symbol Scel
Ensembl Gene ENSMUSG00000022123
Gene Name sciellin
Synonyms 9230114I02Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9130 (G1)
Quality Score 225.009
Status Validated
Chromosome 14
Chromosomal Location 103513342-103612797 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 103533310 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 60 (V60A)
Ref Sequence ENSEMBL: ENSMUSP00000093233 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095576] [ENSMUST00000227322]
AlphaFold Q9EQG3
Predicted Effect probably benign
Transcript: ENSMUST00000095576
AA Change: V60A

PolyPhen 2 Score 0.050 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000093233
Gene: ENSMUSG00000022123
AA Change: V60A

DomainStartEndE-ValueType
low complexity region 111 131 N/A INTRINSIC
low complexity region 159 178 N/A INTRINSIC
internal_repeat_1 204 327 9.24e-7 PROSPERO
internal_repeat_1 378 505 9.24e-7 PROSPERO
low complexity region 525 537 N/A INTRINSIC
LIM 584 642 2.23e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000227322
AA Change: V60A

PolyPhen 2 Score 0.136 (Sensitivity: 0.92; Specificity: 0.86)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 99% (87/88)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a precursor to the cornified envelope of terminally differentiated keratinocytes. This protein localizes to the periphery of cells and may function in the assembly or regulation of proteins in the cornified envelope. Transcript variants encoding different isoforms exist. A transcript variant utilizing an alternative polyA signal has been described in the literature, but its full-length nature has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice are viable and fertile with normal hair morphology and development and normal skin morphology and barrier function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abr A G 11: 76,451,927 C585R possibly damaging Het
Acaca T C 11: 84,311,319 L1380S probably damaging Het
Aifm2 A C 10: 61,727,726 Q125P probably null Het
Ak5 A T 3: 152,472,932 L482* probably null Het
Aldh3a2 T C 11: 61,248,932 Q458R probably benign Het
Ank2 G A 3: 127,016,916 T524I Het
Apoc3 A T 9: 46,235,183 S25T unknown Het
Ash1l A T 3: 89,058,541 R2417* probably null Het
Bbs12 A G 3: 37,319,056 probably benign Het
Birc6 T A 17: 74,612,151 I1992N Het
Brd9 G A 13: 73,944,787 V299M probably damaging Het
Brwd1 A T 16: 96,064,930 N217K probably damaging Het
C3 T C 17: 57,211,678 Y1235C probably damaging Het
Cacna1c T C 6: 118,613,946 Y1538C Het
Ccdc172 T A 19: 58,537,347 H212Q possibly damaging Het
Cdc6 A G 11: 98,912,173 D313G probably damaging Het
Cyp2e1 T C 7: 140,773,109 V353A probably damaging Het
Dlg2 G T 7: 92,431,050 V711F probably damaging Het
Dmac2 T C 7: 25,621,023 F49S probably damaging Het
Dnah7b A G 1: 46,134,514 K660E probably benign Het
Dusp8 A T 7: 142,088,418 S106T probably benign Het
Dynll1 T A 5: 115,300,545 I34F probably benign Het
Epb41l4b A G 4: 57,103,447 F130L possibly damaging Het
Erc2 T C 14: 28,029,461 Y705H probably benign Het
Exosc8 T A 3: 54,731,082 L160F probably damaging Het
F5 A G 1: 164,174,261 T178A probably benign Het
F7 C A 8: 13,035,059 P362T probably damaging Het
Fkbp3 T C 12: 65,065,793 K156E possibly damaging Het
Folh1 G A 7: 86,719,705 T738I probably benign Het
Gatad2b C T 3: 90,348,629 A134V probably benign Het
Glud1 T A 14: 34,335,392 W338R Het
Gm21149 T C 5: 15,475,263 K62E possibly damaging Het
Gm32742 A G 9: 51,138,749 Y1517H probably damaging Het
Grik5 G A 7: 25,068,004 probably benign Het
Gse1 A T 8: 120,568,313 E391V unknown Het
Gxylt2 C T 6: 100,733,368 Q157* probably null Het
Hbq1b C T 11: 32,287,092 T27I probably damaging Het
Hoxd13 T A 2: 74,669,038 D243E probably benign Het
Hsd3b3 T A 3: 98,743,895 I80F possibly damaging Het
Hsf2bp A T 17: 32,011,108 probably benign Het
Itch G A 2: 155,210,125 probably benign Het
Kat14 T C 2: 144,373,822 F76L probably benign Het
Kdm6b T C 11: 69,404,598 T948A unknown Het
Kmt2c A T 5: 25,311,104 H2580Q probably benign Het
Lrp1 T C 10: 127,546,412 T3727A probably benign Het
Lrrc8a A G 2: 30,257,030 I619V possibly damaging Het
Mansc1 C A 6: 134,609,988 G409W probably damaging Het
Map3k11 C A 19: 5,696,010 L418I possibly damaging Het
Mettl4 T A 17: 94,735,485 I308L possibly damaging Het
Myo9a A G 9: 59,832,231 D742G probably damaging Het
Mypn T C 10: 63,192,873 Q137R probably benign Het
Neurod4 A T 10: 130,270,558 Y282* probably null Het
Nup210 A G 6: 91,043,817 F965S probably benign Het
Olfr1031 T G 2: 85,992,475 Y219* probably null Het
Olfr1271 A G 2: 90,266,014 C139R probably damaging Het
Olfr374 G T 8: 72,109,853 G96C probably damaging Het
Olfr780 A G 10: 129,322,028 N135S probably benign Het
Oplah T C 15: 76,300,898 T872A possibly damaging Het
Pkn2 A T 3: 142,809,484 D696E possibly damaging Het
Pla2r1 A T 2: 60,495,385 probably benign Het
Plpp1 A T 13: 112,851,504 I54L Het
Ppp4r2 T G 6: 100,865,152 N191K probably damaging Het
Ptpdc1 G T 13: 48,586,179 P592Q probably benign Het
Qrich2 A T 11: 116,456,866 L1044* probably null Het
Rb1cc1 A G 1: 6,244,885 I421V probably damaging Het
Ripor3 A T 2: 167,981,347 C881* probably null Het
Rreb1 T C 13: 37,930,306 F547S probably benign Het
Shank3 G A 15: 89,558,216 A1771T probably benign Het
Slc6a20a A G 9: 123,640,566 probably null Het
Slfn5 C T 11: 82,960,620 T581I probably damaging Het
Ssh3 A C 19: 4,264,085 V412G probably damaging Het
Stx17 T G 4: 48,159,071 probably benign Het
Sun3 T G 11: 9,018,170 T274P probably benign Het
Tm9sf1 T C 14: 55,638,007 T427A probably damaging Het
Tmem114 T A 16: 8,412,119 I140F Het
Tmem40 T C 6: 115,734,019 R167G possibly damaging Het
Top3a C A 11: 60,750,575 probably null Het
Trafd1 A G 5: 121,378,510 V210A probably benign Het
Trim66 T C 7: 109,477,689 I348V possibly damaging Het
Ttn G A 2: 76,848,828 A10850V unknown Het
Unc80 G A 1: 66,638,085 A2058T possibly damaging Het
Upp2 T C 2: 58,778,008 Y238H probably damaging Het
Vmn1r224 T A 17: 20,419,980 I273N probably damaging Het
Vps13c T C 9: 67,929,523 S1768P probably damaging Het
Zfp26 G A 9: 20,437,427 H614Y probably damaging Het
Zfp263 C T 16: 3,749,837 T672I probably benign Het
Zfp641 T A 15: 98,288,851 Q297L probably benign Het
Zfp944 T C 17: 22,341,050 E25G probably damaging Het
Zfp994 T C 17: 22,200,000 E656G unknown Het
Zfyve19 A G 2: 119,214,849 D206G probably damaging Het
Other mutations in Scel
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00841:Scel APN 14 103529995 missense probably benign 0.01
IGL00913:Scel APN 14 103581809 missense probably benign 0.35
IGL01086:Scel APN 14 103612391 missense probably benign 0.05
IGL01352:Scel APN 14 103533338 missense possibly damaging 0.54
IGL01396:Scel APN 14 103608094 splice site probably benign
IGL01954:Scel APN 14 103603242 splice site probably benign
IGL02064:Scel APN 14 103533326 missense probably damaging 0.98
IGL02186:Scel APN 14 103564821 missense probably benign 0.23
IGL02475:Scel APN 14 103537008 missense possibly damaging 0.95
IGL02926:Scel APN 14 103576247 nonsense probably null
IGL03122:Scel APN 14 103599406 missense possibly damaging 0.66
IGL03135:Scel APN 14 103586514 missense probably benign 0.02
PIT4585001:Scel UTSW 14 103592368 missense possibly damaging 0.90
R0346:Scel UTSW 14 103529984 missense probably damaging 1.00
R0394:Scel UTSW 14 103562518 missense probably benign 0.15
R0418:Scel UTSW 14 103603254 missense probably benign
R0635:Scel UTSW 14 103583139 critical splice donor site probably null
R0815:Scel UTSW 14 103586480 missense possibly damaging 0.83
R0863:Scel UTSW 14 103586480 missense possibly damaging 0.83
R0990:Scel UTSW 14 103581832 missense possibly damaging 0.55
R1084:Scel UTSW 14 103564843 critical splice donor site probably null
R1641:Scel UTSW 14 103533316 missense probably damaging 1.00
R2001:Scel UTSW 14 103610790 missense possibly damaging 0.66
R2002:Scel UTSW 14 103541985 missense probably damaging 1.00
R2341:Scel UTSW 14 103608170 missense possibly damaging 0.92
R3425:Scel UTSW 14 103608106 missense possibly damaging 0.92
R3836:Scel UTSW 14 103592386 missense possibly damaging 0.66
R4035:Scel UTSW 14 103530004 missense probably damaging 1.00
R4197:Scel UTSW 14 103599400 missense probably damaging 0.97
R4737:Scel UTSW 14 103572037 missense possibly damaging 0.79
R4801:Scel UTSW 14 103583100 missense probably benign 0.01
R4802:Scel UTSW 14 103583100 missense probably benign 0.01
R5369:Scel UTSW 14 103586493 missense probably benign 0.00
R5555:Scel UTSW 14 103602206 missense probably benign 0.27
R5582:Scel UTSW 14 103583139 critical splice donor site probably benign
R5931:Scel UTSW 14 103605624 nonsense probably null
R5978:Scel UTSW 14 103529254 splice site probably null
R6045:Scel UTSW 14 103592213 missense probably benign 0.12
R6062:Scel UTSW 14 103585136 missense possibly damaging 0.82
R6218:Scel UTSW 14 103572042 missense probably benign 0.12
R6225:Scel UTSW 14 103591984 missense probably benign 0.27
R7102:Scel UTSW 14 103543832 nonsense probably null
R7349:Scel UTSW 14 103543879 missense probably benign 0.11
R8376:Scel UTSW 14 103572015 missense probably benign 0.02
R8924:Scel UTSW 14 103592371 missense possibly damaging 0.66
R9014:Scel UTSW 14 103585139 missense probably benign
R9135:Scel UTSW 14 103602190 missense probably benign
R9179:Scel UTSW 14 103574400 missense possibly damaging 0.79
R9614:Scel UTSW 14 103605596 missense probably damaging 1.00
R9638:Scel UTSW 14 103541973 missense possibly damaging 0.89
R9672:Scel UTSW 14 103599402 missense possibly damaging 0.82
R9719:Scel UTSW 14 103572006 critical splice acceptor site probably null
X0026:Scel UTSW 14 103591993 missense possibly damaging 0.46
Predicted Primers PCR Primer
(F):5'- ATCCTGCAAGTTGTGGCTG -3'
(R):5'- GTTCTGAGAGCTGACATGGGAC -3'

Sequencing Primer
(F):5'- CTGCAAGTTGTGGCTGGTTAATTTAG -3'
(R):5'- GGACTAAACCCCTAGTGGTATTC -3'
Posted On 2022-01-20